Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure

• US 10,100,304 B2
• Filed: 07/16/2012
• Issued: 10/16/2018
• Est. Priority Date: 03/21/2003
• Status: Active Grant

• Current Assignee: Academisch Ziekenhuis Leiden
• Original Assignee: Academisch Ziekenhuis Leiden
• Inventors: Van Deutekom, Judith Christina Theodora
• Primary Examiner(s): Chong, Kimberly
• Application Number:
  US13/550,210
• Publication Number:
  US 20130072671A1
• Time in Patent Office: 2,283 Days
• Field of Search: None
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61K 48/0016 wherein the nucleic acid is delivered as a 'naked' nucleic acid, i.e. not combined with an entity such as a cationic lipid
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: A61P 21/04 for myasthenia gravis
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C07H 21/02 with ribosyl as saccharide radical
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/111 spanning the whole gene, or a large part of it
• CPC Class Codes: C12N 2310/31 of the backbone
• CPC Class Codes: C12N 2310/314 Phosphoramidates
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: C12N 2310/3181 Peptide nucleic acid, PNA
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/3231 having an additional ring, e.g. LNA, ENA
• CPC Class Codes: C12N 2310/3233 Morpholino-type ring
• CPC Class Codes: C12N 2310/346 having a combination of backbone and sugar modifications
• CPC Class Codes: C12N 2310/3521 Methyl
• CPC Class Codes: C12N 2320/30 : Special therapeutic applications
• CPC Class Codes: C12N 2320/33 : Alteration of splicing
• CPC Class Codes: C12Q 1/6883 : for diseases caused by alterations of genetic material
• CPC Class Codes: G01N 33/6887 : from muscle, cartilage or connective tissue

Abstract

The invention provides a method for generating an oligonucleotide with which an exon may be skipped in a pre-mRNA and thus excluded from a produced mRNA thereof. Further provided are methods for altering the secondary structure of an mRNA to interfere with splicing processes and uses of the oligonucleotides and methods in the treatment of disease. Further provided are pharmaceutical compositions and methods and means for inducing skipping of several exons in a pre-mRNA.

Claims

1. An antisense oligonucleotide of 15 to 24 nucleotides in length, comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO:

27), wherein the antisense oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA, and wherein the antisense oligonucleotide comprises a modification.

2. The oligonucleotide of claim 1, wherein the modification is a morpholine ring.

3. The oligonucleotide of claim 1, wherein the modification is a phosphorodiamidate internucleoside linkage.

4. The oligonucleotide of claim 1, wherein the modification is a peptide nucleic acid and/or locked nucleic acid.

5. The oligonucleotide of claim 3, wherein each linkage is a phosphorodiamidate internucleoside linkage.

6. The oligonucleotide of claim 1, wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide.

7. The oligonucleotide of claim 1, wherein the modification is a 2′

-O-methyl ribose moiety.

8. The oligonucleotide of claim 1, wherein the modification is a phosphorothioate internucleoside linkage.

9. The oligonucleotide of claim 8, wherein each internucleoside linkage is a phosphorothioate linkage.

10. The oligonucleotide of claim 7, wherein said oligonucleotide is a 2′

-O-methyl phosphorothioate oligonucleotide.

11. The oligonucleotide of claim 1, wherein the oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA and dystrophin expression in the muscle cell upon transfection of human muscle cells with at least 100 nM of said oligonucleotide and incubation for at least 16 hours.

12. The antisense oligonucleotide of claim 11, wherein exon 51 skipping is detected by RT-PCR and/or sequence analysis.

13. The oligonucleotide of claim 11, wherein dystrophin expression in the muscle cell is detected by immunohistochemical and/or western blot analysis.

14. The oligonucleotide of claim 1, wherein the modification confers increased resistance to RNAseH.