Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
First Claim
Patent Images
1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA in a patient or cell derived from the patient, said method comprising providing to said patient or said cell, an oligonucleotide of 15 to 24 nucleotides in length comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO:
- 27), wherein said oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA in the patient or a cell derived from the patient.
2 Assignments
0 Petitions
Accused Products
Abstract
The invention relates to oligonucleotides for inducing skipping of exon 55 of the dystrophin gene. The invention also relates to methods of inducing exon 55 skipping using the oligonucleotides.
119 Citations
21 Claims
-
1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA in a patient or cell derived from the patient, said method comprising providing to said patient or said cell, an oligonucleotide of 15 to 24 nucleotides in length comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO:
- 27), wherein said oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA in the patient or a cell derived from the patient.
- View Dependent Claims (3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21)
-
2. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) in a patient by inducing the skipping of exon 51 of the human dystrophin pre-mRNA, said method comprising providing to a cell of said patient, an oligonucleotide of 15 to 24 nucleotides in length comprising at least 15 consecutive bases of the base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO:
- 27), wherein said oligonucleotide induces exon 51 skipping of said exon in the human dystrophin pre-mRNA of the patient.
Specification