×

Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure

  • US 10,190,116 B2
  • Filed: 03/06/2014
  • Issued: 01/29/2019
  • Est. Priority Date: 03/21/2003
  • Status: Active Grant
First Claim
Patent Images

1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA in a patient or cell derived from the patient, said method comprising providing to said patient or said cell, an oligonucleotide of 15 to 24 nucleotides in length comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO:

  • 27), wherein said oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA in the patient or a cell derived from the patient.

View all claims
  • 2 Assignments
Timeline View
Assignment View
    ×
    ×