Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

• US 10,227,611 B2
• Filed: 11/16/2015
• Issued: 03/12/2019
• Est. Priority Date: 05/25/2012
• Status: Active Grant

• Current Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Original Assignee: Emmanuelle Charpentier, The University Of Vienna, Regents of the University of California (University of California)
• Inventors: Doudna, Jennifer A., Jinek, Martin, Chylinski, Krzysztof, Charpentier, Emmanuelle
• Primary Examiner(s): Hammell, Neil P
• Application Number:
  US14/942,782
• Publication Number:
  US 20160138008A1
• Time in Patent Office: 1,212 Days
• Field of Search: None
• CPC Class Codes: A01H 6/4684 Zea mays [maize]
• CPC Class Codes: A01K 67/027 New or modified breeds of vertebrates
• CPC Class Codes: A61K 38/465 acting on ester bonds (3.1), e.g. lipases, ribonucleases
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/746 for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/902 using homologous recombination
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/13 Decoys
• CPC Class Codes: C12N 2310/14 : interfering N.A.
• CPC Class Codes: C12N 2310/20 : involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/32 : of the sugar
• CPC Class Codes: C12N 2310/33 : of the base
• CPC Class Codes: C12N 2310/3519 : Fusion with another nucleic acid
• CPC Class Codes: C12N 2310/531 : Stem-loop; Hairpin
• CPC Class Codes: C12N 2800/80 : Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/22 : Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Q 1/686 : Polymerase chain reaction [PCR]
• CPC Class Codes: C12Y 301/04 : Phosphoric diester hydrolases (3.1.4)
• CPC Class Codes: H01L 21/02312 : treatment by exposure to a gas or vapour
• CPC Class Codes: H01L 21/02365 : Forming inorganic semiconducting materials on a substrate for light-sensitive devices H01L31/00
• CPC Class Codes: H01L 33/0075 : comprising nitride compounds
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

1. A method of modifying a target DNA molecule in a cell, the method comprising contacting a target DNA molecule inside of a cell with:

(a) a Cas9 protein; and

(b) a single molecule DNA-targeting RNA comprising, in 5′

to 3′

order;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA molecule,

(ii) a nucleotide linker; and

(iii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,

wherein (a) forms a complex with (b) and the target DNA molecule is modified.

2. The method of claim 1, wherein the target DNA molecule is modified by being cleaved.

3. The method of claim 1, wherein the method comprises introducing into the cell:

(1) the single molecule DNA-targeting RNA, or a DNA molecule that encodes the single molecule DNA-targeting RNA; and

(2) the Cas9 protein, an RNA molecule that encodes the Cas9 protein, or a DNA molecule that encodes the Cas9 protein.

4. The method of claim 3, wherein the DNA molecule that encodes the single molecule DNA-targeting RNA and/or the DNA molecule that encodes the Cas9 protein is a recombinant expression vector.

5. The method of claim 3, wherein the method comprises introducing into the cell a DNA molecule that encodes both the single molecule DNA-targeting RNA and the Cas9 protein.

6. The method of claim 3, wherein the RNA molecule or the DNA molecule of (2) comprises a nucleotide sequence that is modified relative to a corresponding wild-type nucleotide sequence encoding a Cas9 protein, wherein the modification replaces one or more codons in the wild-type nucleotide sequence with one or more different codons encoding the same amino acid.

7. The method of claim 3, wherein the method comprises introducing a donor polynucleotide into the cell.

8. The method of claim 3, wherein the method comprises introducing two or more single molecule DNA-targeting RNAs into the cell, wherein the two or more single molecule DNA-targeting RNAs are complementary to different target sequences within the same or different target DNA molecules.

9. The method of claim 8, wherein the two or more single molecule DNA-targeting RNAs are introduced into the cell at the same time.

10. The method of claim 1, wherein said contacting comprises inducing expression of (a) and/or (b).

11. The method of claim 1, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

12. The method of claim 1, wherein:

the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO;

     679),

the nucleotide linker comprises the 4 nt sequence 5′

-GAAA-3′

, and

the activator-RNA comprises the 67 nt tracrRNA sequence 5′

-UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUUUUUU-3′

(SEQ ID NO;

     432).

13. The method of claim 1, wherein (i) comprises the crRNA sequence GUUUUAGAGCUA (SEQ ID NO:

679) and (iii) comprises the tracrRNA sequence 5′

-UAGCAAGUUAAAAUAAGGCUAGUCCG-3′

(SEQ ID NO;

     397).