RNA interference for the treatment of gain-of-function disorders

• US 10,344,277 B2
• Filed: 08/02/2016
• Issued: 07/09/2019
• Est. Priority Date: 09/12/2003
• Status: Active Grant

• Current Assignee: University Of Massachusetts
• Original Assignee: University Of Massachusetts
• Inventors: Aronin, Neil, Zamore, Phillip D.
• Primary Examiner(s): Zara, Jane J
• Application Number:
  US15/226,476
• Publication Number:
  US 20170051283A1
• Time in Patent Office: 1,071 Days
• Field of Search: 435 61, 435 611, 435 9, 435 11, 435 9131, 435455, 435 911, 435458, 514 44, 536 231, 536 245
• CPC Class Codes: A61K 48/005 characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• CPC Class Codes: A61P 25/00 Drugs for disorders of the nervous system
• CPC Class Codes: A61P 25/28 for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• CPC Class Codes: C07H 21/02 with ribosyl as saccharide radical
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 2310/14 interfering N.A.
• CPC Class Codes: C12N 2310/3515 Lipophilic moiety, e.g. cholesterol
• CPC Class Codes: C12N 2310/531 Stem-loop; Hairpin
• CPC Class Codes: C12N 2320/30 Special therapeutic applications
• CPC Class Codes: C12N 2320/34 Allele or polymorphism specific uses
• CPC Class Codes: C12N 5/06 Animal cells or tissues; Human cells or tissues preservation of living cells or tissues A01N1/02

Abstract

The present invention relates to the discovery of an effective treatment for a variety of gain-of-function diseases, in particular, Huntington'"'"'s disease (HD). The present invention utilizes RNA Interference technology (RNAi) against polymorphic regions in the genes encoding various gain-of-function mutant proteins resulting in an effective treatment for the gain-of-function disease.

Claims

1. A method of treating or managing Huntington'"'"'s disease, comprising administering to the patient in need of such treatment or management a therapeutically effective amount of a vector that expresses an effective amount of an engineered RNA precursor targeting UAAGAGAUGGGGACAGUACUUCAACGCUAGAAGAACA (SEQ ID NO:

43) of the Htt mRNA, such that RNA silencing of said mRNA occurs, wherein the engineered RNA precursor comprises (i) an antisense strand or a variant thereof having sufficient complementarity to SEQ ID NO;

43 to direct target-specific cleavage or translational repression of the Htt mRNA; and

(ii) a sense strand or a variant thereof that is substantially complementary to the antisense strand, such that the sense and antisense strands are capable of annealing together.

2. The method of claim 1, wherein the vector is a viral vector, retroviral vector, expression cassette, or plasmid.

3. The method of claim 1, wherein the vector further comprises an RNA Polymerase III or RNA Polymerase II promoter.

4. The method of claim 3, wherein the RNA Polymerase III promoter is the U6 or H1 promoter.

5. The method of claim 1, wherein the engineered RNA precursor contains at least one internal bulge.

6. The method of claim 1, wherein each strand of the engineered RNA precursor is between 15 and 50 base pairs in length.