Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

• US 10,351,878 B2
• Filed: 11/27/2018
• Issued: 07/16/2019
• Est. Priority Date: 05/25/2012
• Status: Active Grant

• Current Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Original Assignee: Regents of the University of California (University of California)
• Inventors: Doudna, Jennifer A., Jinek, Martin, Chylinski, Krzysztof, Charpentier, Emmanuelle
• Primary Examiner(s): Hammell, Neil P
• Application Number:
  US16/201,855
• Publication Number:
  US 20190106713A1
• Time in Patent Office: 231 Days
• Field of Search: None
• CPC Class Codes: A01H 6/4684 Zea mays [maize]
• CPC Class Codes: A01K 67/027 New or modified breeds of vertebrates
• CPC Class Codes: A61K 38/465 acting on ester bonds (3.1), e.g. lipases, ribonucleases
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/746 for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/902 using homologous recombination
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/13 Decoys
• CPC Class Codes: C12N 2310/14 : interfering N.A.
• CPC Class Codes: C12N 2310/20 : involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/32 : of the sugar
• CPC Class Codes: C12N 2310/33 : of the base
• CPC Class Codes: C12N 2310/3519 : Fusion with another nucleic acid
• CPC Class Codes: C12N 2310/531 : Stem-loop; Hairpin
• CPC Class Codes: C12N 2800/80 : Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/22 : Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Q 1/686 : Polymerase chain reaction [PCR]
• CPC Class Codes: C12Y 301/04 : Phosphoric diester hydrolases (3.1.4)
• CPC Class Codes: H01L 21/02312 : treatment by exposure to a gas or vapour
• CPC Class Codes: H01L 21/02365 : Forming inorganic semiconducting materials on a substrate for light-sensitive devices H01L31/00
• CPC Class Codes: H01L 33/0075 : comprising nitride compounds
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

1. A method of producing a genetically modified cell comprising:

(1) introducing into a target cell comprising a target DNA;

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA -targeting RNA comprises, in 5′

to 3′

order;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,

wherein (i) and (ii) are covalently linked by interveningnucleotides,

wherein said introducing results in modification of the target DNA thereby producing the genetically modified cell; and

then

(2) culturing said genetically modified cell to produce a population of cells.

2. The method of claim 1, wherein said modification is cleavage.

3. The method of claim 2, wherein the method further comprises introducing a donor polynucleotide into the target cell.

4. The method of claim 3, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain.

5. The method of claim 1, wherein the Cas9 protein is fused to a heterologous polypeptide that has DNA modifying activity.

6. The method of claim 1, wherein:

(a) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUUU (SEQ ID NO;

     432);

or

(b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO;

     397);

or

(c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO;

     679), the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUUU (SEQ ID NO;

     432).

7. The method of claim 1, wherein the single molecule DNA-targeting RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

8. A method of making a genetically modified cell, the method comprising:

contacting a population of target cells with;

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′

to 3′

order;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of a target DNA inside of one or more target cells of said population of target cells; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,

wherein (i) and (ii) are covalently linked by intervening nucleotides,

wherein said contacting results in modification of the target DNA inside of one or more target cells of said population of target cells, thereby producing one or more genetically modified cells.

9. The method of claim 8, wherein the method further comprises, after said contacting, separating said one or more genetically modified cells from the population of target cells.

10. The method of claim 8, wherein the Cas9 protein is fused to a heterologous polypeptide.

11. The method of claim 8, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of:

a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6xHis tag, a hemagglutinin (HA) tag, and green fluorescent protein.

12. The method of claim 8, wherein the Cas9 protein is fused to a heterologous polypeptide that has DNA modifying activity.

13. The method of claim 8, wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.

14. The method of claim 8, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.

15. The method of claim 8, wherein the single molecule DNA-targeting RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

16. The method of claim 8, wherein the single molecule DNA-targeting RNA comprises one or more of:

a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′

-substituted sugar moiety, a 2′

-O-methoxyethyl modified sugar moiety, a 2′

-O-methyl modified sugar moiety, a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-fluoro modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

17. The method of claim 8, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety.

18. The method of claim 8, wherein the single molecule DNA-targeting RNA comprises one or more of the following heterologous moieties:

a polyamine;

a polyamide;

a polyethylene glycol;

a polyether;

a cholesterol moiety;

a cholic acid;

a thioester;

a thiocholesterol;

a lipid;

an aliphatic chain;

a phospholipid;

an adamantane acetic acid;

a palmityl moiety;

an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety;

a biotin;

a phenazine;

a folate;

a phenanthridine;

an anthraquinone;

an acridine;

a fluorescein;

a rhodamine;

a coumarin; and

a dye.

19. The method of claim 8, wherein:

(a) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUUU (SEQ ID NO;

     432);

or

(b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO;

     397);

or

(c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO;

     679), the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUUU (SEQ ID NO;

     432).

20. The method of claim 8, wherein the method comprises contacting the population of target cells with two or more single molecule DNA-targeting RNAs, or one or more nucleic acids encoding the two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences.

21. The method of claim 8, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

22. The method of claim 8, wherein the method comprises contacting the population of target cells with a DNA molecule that encodes both the single molecule DNA-targeting RNA and the Cas9 protein.

23. The method of claim 8, wherein the method comprises inducing expression of the Cas9 protein and/or the single molecule DNA-targeting RNA.

24. The method of claim 8, wherein said modification is cleavage.

25. The method of claim 24, wherein the method further comprises, after said contacting, separating said one or more genetically modified cells from the population of target cells.

26. The method of claim 24, wherein the method further comprises contacting the population of target cells with a donor polynucleotide.

27. The method of claim 24, wherein the Cas9 protein is fused to a heterologous polypeptide.

28. The method of claim 24, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain.

29. The method of claim 28, wherein the method further comprises contacting the population of target cells with a donor polynucleotide.

30. The method of claim 24, wherein the method comprises contacting the population of target cells with two or more single molecule DNA-targeting RNAs, or one or more nucleic acids encoding the two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences.