Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

• US 10,421,980 B2
• Filed: 07/11/2018
• Issued: 09/24/2019
• Est. Priority Date: 05/25/2012
• Status: Active Grant

• Current Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Original Assignee: Regents of the University of California (University of California)
• Inventors: Doudna, Jennifer A., Jinek, Martin, Chylinski, Krzysztof, Charpentier, Emmanuelle
• Primary Examiner(s): Hammell, Neil P
• Application Number:
  US16/033,002
• Publication Number:
  US 20180312874A1
• Time in Patent Office: 440 Days
• Field of Search: None
• CPC Class Codes: A01H 6/4684 Zea mays [maize]
• CPC Class Codes: A01K 67/027 New or modified breeds of vertebrates
• CPC Class Codes: A61K 38/465 acting on ester bonds (3.1), e.g. lipases, ribonucleases
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/746 for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/902 using homologous recombination
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/13 Decoys
• CPC Class Codes: C12N 2310/14 : interfering N.A.
• CPC Class Codes: C12N 2310/20 : involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/32 : of the sugar
• CPC Class Codes: C12N 2310/33 : of the base
• CPC Class Codes: C12N 2310/3519 : Fusion with another nucleic acid
• CPC Class Codes: C12N 2310/531 : Stem-loop; Hairpin
• CPC Class Codes: C12N 2800/80 : Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/22 : Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Q 1/686 : Polymerase chain reaction [PCR]
• CPC Class Codes: C12Y 301/04 : Phosphoric diester hydrolases (3.1.4)
• CPC Class Codes: H01L 21/02312 : treatment by exposure to a gas or vapour
• CPC Class Codes: H01L 21/02365 : Forming inorganic semiconducting materials on a substrate for light-sensitive devices H01L31/00
• CPC Class Codes: H01L 33/0075 : comprising nitride compounds
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

1. A composition comprising a DNA-targeting RNA or a nucleic acid encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the targeter-RNA and the activator-RNA are covalently linked, and

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

2. The composition of claim 1, wherein the nucleic acid encoding the DNA-targeting RNA is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.

3. The composition of claim 1, wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence

4. The composition of claim 1, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

5. The composition of claim 1, comprising the DNA-targeting RNA, wherein the targeter-RNA and/or the activator-RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

6. The composition of claim 1, comprising the DNA-targeting RNA, wherein the targeter-RNA and/or the activator-RNA comprises one or more of:

a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′

-O-methoxyethyl modified sugar moiety, a 2′

-O-methyl modified sugar moiety, a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-fluoro modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

7. The composition of claim 1, wherein the DNA-targeting RNA, or the nucleic acid encoding the DNA-targeting RNA, is conjugated to one or more of:

a polyamine;

a polyamide;

a polyethylene glycol;

a polyether;

a cholesterol moiety;

a cholic acid;

a thioether;

a thiocholesterol;

an aliphatic chain;

a phospholipid;

an adamantane acetic acid;

a palmityl moiety;

an octadecylamine moiety;

a hexylamino-carbonyl-oxycholesterol moiety;

a biotin;

a phenazine;

a folate;

a phenanthridine;

an anthraquinone;

an acridine;

a fluorescein;

a rhodamine;

a dye; and

a coumarin.

8. A composition comprising a DNA-targeting RNA or a nucleic acid encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs,

wherein the targeter-RNA and activator-RNA are covalently linked, and

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

9. The composition of claim 8, wherein the nucleic acid encoding the DNA-targeting RNA is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.

10. The composition of claim 8, wherein the activator-RNA comprises the 26 nucleotide tracrRNA set forth in SEQ ID NO:

441.

11. The composition of claim 8, comprising the DNA-targeting RNA, wherein the targeter-RNA and/or the activator-RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

12. The composition of claim 8, comprising the DNA-targeting RNA, wherein the targeter-RNA and/or the activator-RNA comprises one or more of:

a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′

-O-methoxyethyl modified sugar moiety, a 2′

-O-methyl modified sugar moiety, a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-fluoro modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

13. The composition of claim 8, wherein the DNA-targeting RNA, or the nucleic acid encoding the DNA-targeting RNA, is conjugated to one or more of:

a polyamine;

a polyamide;

a polyethylene glycol;

a polyether;

a cholesterol moiety;

a cholic acid;

a thioether;

a thiocholesterol;

an aliphatic chain;

a phospholipid;

an adamantane acetic acid;

a palmityl moiety;

an octadecylamine moiety;

a hexylamino-carbonyl-oxycholesterol moiety;

a biotin;

a phenazine;

a folate;

a phenanthridine;

an anthraquinone;

an acridine;

a fluorescein;

a rhodamine;

a dye; and

a coumarin.

14. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the targeter-RNA and the activator-RNA are covalently and wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

15. The method of claim 14, wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

16. The method of claim 14, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

17. The method of claim 14, wherein the Cas9 protein is capable of cleaving only one strand of DNA and comprises one or more mutations in a RuvC domain or an HNH domain.

18. The method of claim 14, wherein the method comprises introducing into a cell:

(1) the DNA-targeting RNA, or a nucleic acid that encodes the DNA-targeting and/or

(2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

19. The method of claim 18, wherein the method comprises introducing the DNA-targeting RNA into the cell.

20. The method of claim 18, wherein the method comprises introducing a donor polynucleotide into the cell.

21. The method of claim 18, wherein the nucleic acid that encodes the DNA-targeting RNA and/or the nucleic acid that encodes the Cas9 protein is a recombinant expression vector.

22. The method of claim 18, wherein the method comprises introducing two or more DNA-targeting RNAs into the cell.

23. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs,

wherein the targeter-RNA and the activator-RNA are covalently linked, and wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

24. The method of claim 23, wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

25. The method of claim 23, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or an 1 NH domain.

26. The method of claim 23, wherein the method comprises introducing into a cell:

(1) the DNA-targeting RNA, or a nucleic acid that encodes the DNA-targeting RNA; and

/or

(2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

27. The method of claim 26, wherein the method comprises introducing the DNA-targeting RNA into the cell.

28. The method of claim 26, wherein the method comprises introducing a donor polynucleotide into the cell.

29. The method of claim 26, wherein the nucleic acid that encodes the DNA-targeting RNA and/or the nucleic acid that encodes the Cas9 protein is a recombinant expression vector.

30. The method of claim 26, wherein the method comprises introducing two or more DNA-targeting RNAs into the cell.