Method for treating schizophrenia

• US 10,441,601 B2
• Filed: 06/30/2016
• Issued: 10/15/2019
• Est. Priority Date: 06/30/2015
• Status: Active Grant

• Current Assignee: St Jude Children's Research Hospital Incorporated (Abbott Laboratories)
• Original Assignee: St Jude Children's Research Hospital Incorporated (Abbott Laboratories)
• Inventors: Zakharenko, Stanislav S.
• Primary Examiner(s): Poliakova-Georgantas, Ekaterina
• Application Number:
  US15/740,687
• Publication Number:
  US 20180318331A1
• Time in Patent Office: 1,202 Days
• Field of Search: None
• CPC Class Codes: A61K 31/713 Double-stranded nucleic acids or oligonucleotides
• CPC Class Codes: A61K 9/0043 Nose
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/861 Adenoviral vectors
• CPC Class Codes: C12N 2310/141 MicroRNAs, miRNAs
• CPC Class Codes: C12Q 1/6841 In situ hybridisation
• CPC Class Codes: C12Q 1/6883 for diseases caused by alterations of genetic material
• CPC Class Codes: C12Q 2600/106 Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
• CPC Class Codes: C12Q 2600/178 miRNA, siRNA or ncRNA
• CPC Class Codes: G01N 2800/302 Schizophrenia

Abstract

The invention is directed to a method for treating the 22q11 deletion syndrome (22q11 DS) and schizophrenia (SCZ) by replenishment of decreased levels of miR-338-3p in thalamic neurons.

Claims

1. A method for treatment of schizophrenia or 22q11 deletion syndrome in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (i) miR-338-3p or a mimic or a functional derivative thereof, or (ii) a vector expressing said miR-338-3p or mimic or functional derivative thereof, or (iii) an agent capable of increasing the level or activity of miR-338-3p, wherein the miR-338-3p or mimic or derivative thereof comprises the sequence UCCAGCAUCAGUGAUUUUGUUG (SEQ ID NO:

1).

2. The method of claim 1, wherein the treatment of schizophrenia results in treatment of a positive symptom of schizophrenia in the subject, wherein the positive symptom of schizophrenia is selected from the group consisting of hallucinations, delusions, disorganized thought, and psychosis.

3. The method of claim 1, wherein the miR-338-3p or mimic or derivative thereof consists of the sequence UCCAGCAUCAGUGAUUUUGUUG (SEQ ID NO:

1).

4. The method of claim 1, wherein the administration is systemic, intranasal or targeted to the thalamus.

5. The method of claim 1, wherein the administration results in an increase in the level of miR-338-3p in thalamic neurons of the subject to the level found in healthy subjects.

6. The method of claim 1, wherein the administration results in a decrease in sensitivity of thalamic neurons of the subject to an antipsychotic agent.

7. The method of claim 1, wherein the subject has a decreased level of miR-338-3p in thalamic neurons as compared to a control, wherein the control is a predetermined standard, or the level of miR-338-3p in thalamic neurons of a healthy age- and gender-matched subject or an average value for several such subjects.

8. The method of claim 1, further comprising determining the level of miR-338-3p in thalamic neurons or a bodily fluid sample obtained from the subject.

9. The method of claim 8, wherein the bodily fluid is selected from the group consisting of blood, urine, saliva, and cerebrospinal fluid (CSF).

10. The method of claim 8, wherein the level of miR-338-3p is determined prior to the administration of the treatment.

11. The method of claim 8, wherein the level of miR-338-3p is determined both prior and after the administration of the treatment.