×

Method for treating schizophrenia

  • US 10,441,601 B2
  • Filed: 06/30/2016
  • Issued: 10/15/2019
  • Est. Priority Date: 06/30/2015
  • Status: Active Grant
First Claim
Patent Images

1. A method for treatment of schizophrenia or 22q11 deletion syndrome in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (i) miR-338-3p or a mimic or a functional derivative thereof, or (ii) a vector expressing said miR-338-3p or mimic or functional derivative thereof, or (iii) an agent capable of increasing the level or activity of miR-338-3p, wherein the miR-338-3p or mimic or derivative thereof comprises the sequence UCCAGCAUCAGUGAUUUUGUUG (SEQ ID NO:

  • 1).

View all claims
  • 1 Assignment
Timeline View
Assignment View
    ×
    ×