Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

• US 10,570,419 B2
• Filed: 04/11/2019
• Issued: 02/25/2020
• Est. Priority Date: 05/25/2012
• Status: Active Grant

• Current Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Original Assignee: Regents of the University of California (University of California)
• Inventors: Doudna, Jennifer A., Jinek, Martin, Chylinski, Krzysztof, Charpentier, Emmanuelle
• Primary Examiner(s): Hammell, Neil P
• Application Number:
  US16/382,100
• Publication Number:
  US 20190271008A1
• Time in Patent Office: 320 Days
• Field of Search: None
• CPC Class Codes: A01H 6/4684 Zea mays [maize]
• CPC Class Codes: A01K 67/027 New or modified breeds of vertebrates
• CPC Class Codes: A61K 38/465 acting on ester bonds (3.1), e.g. lipases, ribonucleases
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/746 for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/902 using homologous recombination
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/13 Decoys
• CPC Class Codes: C12N 2310/14 : interfering N.A.
• CPC Class Codes: C12N 2310/20 : involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/32 : of the sugar
• CPC Class Codes: C12N 2310/33 : of the base
• CPC Class Codes: C12N 2310/3519 : Fusion with another nucleic acid
• CPC Class Codes: C12N 2310/531 : Stem-loop; Hairpin
• CPC Class Codes: C12N 2800/80 : Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/22 : Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Q 1/686 : Polymerase chain reaction [PCR]
• CPC Class Codes: C12Y 301/04 : Phosphoric diester hydrolases (3.1.4)
• CPC Class Codes: H01L 21/02312 : treatment by exposure to a gas or vapour
• CPC Class Codes: H01L 21/02365 : Forming inorganic semiconducting materials on a substrate for light-sensitive devices H01L31/00
• CPC Class Codes: H01L 33/0075 : comprising nitride compounds
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

1. A composition comprising a DNA-targeting RNA that comprises:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,

wherein (i) and (ii) are covalently linked,

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

2. The composition of claim 1, wherein the DNA-targeting RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

3. The composition of claim 2, wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.

4. The composition of claim 2, wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage.

5. The composition of claim 1, wherein the DNA-targeting RNA comprises a phosphorothioate internucleoside linkage.

6. The composition of claim 1, wherein the DNA-targeting RNA comprises a non-natural internucleoside linkage that comprises one or more of:

a phosphorothioate, a phosphoramidate, a non-phosphodiester, a heteroatom, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, a 3′

-alkylene phosphonates, a 5′

-alkylene phosphonate, a chiral phosphonate, a phosphinate, a 3′

-amino phosphoramidate, an aminoalkylphosphoramidate, a phosphorodiamidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a selenophosphate, and a boranophosphate.

7. The composition of claim 1, wherein the DNA-targeting RNA comprises one or more of:

(i) a non-natural internucleoside linkage that is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage;

(ii) a locked nucleic acid (LNA); and

(iii) a modified sugar moiety that is 2′

-O-methoxyethyl, 2′

-O-methyl, or 2′

-fluoro.

8. The composition of claim 1, wherein the DNA-targeting RNA comprises one or more of:

a peptide nucleic acid (PNA), a morpholino nucleic acid, a cyclohexenyl nucleic acid (CeNA), and a locked nucleic acid (LNA).

9. The composition of claim 1, wherein the DNA-targeting RNA comprises one or more of:

a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, a 2′

-O-methyl modified sugar moiety, and a 2′

-fluoro modified sugar moiety.

10. The composition of claim 1, wherein the DNA-targeting RNA comprises one or more of:

a 5-methylcytosine;

a 5-hydroxymethyl cytosine;

a xanthine;

a hypoxanthine;

a 2-aminoadenine;

a 6-methyl derivative of adenine;

a 6-methyl derivative of guanine;

a 2-propyl derivative of adenine;

a 2-propyl derivative of guanine;

a 2-thiouracil;

a 2-thiothymine;

a 2-thiocytosine;

a 5-propynyl uracil;

a 5-propynyl cytosine;

a 6-azo uracil;

a 6-azo cytosine;

a 6-azo thymine;

a pseudouracil;

a 4-thiouracil;

an 8-haloadenin;

an 8-aminoadenin;

an 8-thioladenin;

an 8-thioalkyladenin;

an 8-hydroxyladenin;

an 8-haloguanin;

an 8-aminoguanin;

an 8-thiolguanin;

an 8-thioalkylguanin;

an 8-hydroxylguanin;

a 5-halouracil;

a 5-bromouracil;

a 5-trifluoromethyluracil;

a 5-halocytosine;

a 5-bromocytosine;

a 5-trifluoromethylcytosine, a 5-substituted uracil;

a 5-substituted cytosine;

a 7-methylguanine;

a 7-methyladenine;

a 2-F-adenine;

a 2-amino-adenine;

an 8-azaguanine;

an 8-azaadenine;

a 7-deazaguanine;

a 7-deazaadenine;

a 3-deazaguanine;

a 3-deazaadenine;

a tricyclic pyrimidine;

a phenoxazine cytidine;

a phenothiazine cytidine;

a substituted phenoxazine cytidine;

a carbazole cytidine;

a pyridoindole cytidine;

a 7-deazaguanosine;

a 2-aminopyridine;

a 2-pyridone;

a 5-substituted pyrimidine;

a 6-azapyrimidine;

an N-2, N-6 or O-6 substituted purine;

a 2-aminopropyladenine;

a 5-propynyluracil; and

a 5-propynylcytosine.

11. The composition of claim 1, wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO:

432).

12. The composition of claim 1, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

13. The composition of claim 1, wherein the composition is sterile.

14. The composition of claim 1, comprising a nuclease inhibitor.

15. The composition of claim 1, comprising a buffering agent.

16. The composition of claim 15, wherein the buffering agent is a buffer for stabilizing nucleic acids.

17. The composition of claim 1, comprising a pharmaceutically-acceptable, non-toxic carrier or diluent.

18. The composition of claim 1, comprising one or more of:

a detergent, a carbohydrate, a polyamine, an amino acid, a peptide, sodium, potassium, calcium, magnesium, manganese, and a lipid.

19. The composition of claim 1, wherein the composition is lyophilized.

20. The composition of claim 1, wherein the composition is a therapeutic formulation for administration to an animal or human.

21. The composition of claim 1, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15 nucleotides (nt) to 18 nt long.

22. The composition of claim 1, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 18 nucleotides (nt) to 25 nt long.

23. The DNA-targeting RNA of claim 1, wherein the DNA-targeting RNA comprises one or more non-naturally-occurring nucleotides.

24. The DNA-targeting RNA of claim 23, wherein the one or more non-naturally-occurring nucleotides are modified at one or more of:

a ribose, a phosphate, and a base moiety.

25. The DNA-targeting RNA of claim 23, wherein said one or more non-naturally-occurring nucleotides comprises a 2′

-O-methyl analog.

26. The DNA-targeting RNA of claim 23, wherein said one or more non-naturally-occurring nucleotides comprises a 2′

-fluoro analog.

27. A composition comprising a DNA-targeting RNA that comprises:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a 15 nucleotide (nt) to 25 nt long target sequence of a target DNA, and

(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,

wherein (i) and (ii) are covalently linked,

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

28. The composition of claim 27, wherein the composition is lyophilized.

29. The composition of claim 27, wherein the DNA-targeting RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

30. The composition of claim 29, wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.