Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

• US 10,597,680 B2
• Filed: 04/12/2019
• Issued: 03/24/2020
• Est. Priority Date: 05/25/2012
• Status: Active Grant

• Current Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Original Assignee: Regents of the University of California (University of California)
• Inventors: Doudna, Jennifer A., Jinek, Martin, Chylinski, Krzysztof, Charpentier, Emmanuelle
• Primary Examiner(s): Hammell, Neil P
• Application Number:
  US16/383,443
• Publication Number:
  US 20190330662A1
• Time in Patent Office: 347 Days
• Field of Search: None
• CPC Class Codes: A01H 6/4684 Zea mays [maize]
• CPC Class Codes: A01K 67/027 New or modified breeds of vertebrates
• CPC Class Codes: A61K 38/465 acting on ester bonds (3.1), e.g. lipases, ribonucleases
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/746 for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/902 using homologous recombination
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/13 Decoys
• CPC Class Codes: C12N 2310/14 : interfering N.A.
• CPC Class Codes: C12N 2310/20 : involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/32 : of the sugar
• CPC Class Codes: C12N 2310/33 : of the base
• CPC Class Codes: C12N 2310/3519 : Fusion with another nucleic acid
• CPC Class Codes: C12N 2310/531 : Stem-loop; Hairpin
• CPC Class Codes: C12N 2800/80 : Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/22 : Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Q 1/686 : Polymerase chain reaction [PCR]
• CPC Class Codes: C12Y 301/04 : Phosphoric diester hydrolases (3.1.4)
• CPC Class Codes: H01L 21/02312 : treatment by exposure to a gas or vapour
• CPC Class Codes: H01L 21/02365 : Forming inorganic semiconducting materials on a substrate for light-sensitive devices H01L31/00
• CPC Class Codes: H01L 33/0075 : comprising nitride compounds
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

1. A method of making a genetically modified cell, comprising:

introducing into a target cell comprising a target DNA;

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a double molecule DNA-targeting RNA or one or more nucleic acids encoding the double molecule DNA-targeting RNA, wherein the double molecule DNA-targeting RNA comprises;

(i) a targeter-RNA that comprises;

a first nucleotide sequence that is complementary to and hybridizes with a 15 to 25 nucleotide long target sequence of the target DNA, and

a second nucleotide sequence that hybridizes with an activator-RNA to form a double-stranded RNA duplex, wherein the first and second nucleotide sequences are heterologous to one another, and

(ii) the activator-RNA,

wherein the second nucleotide sequence of the targeter-RNA hybridizes with the activator-RNA to form a total of 8 to 15 base pairs,

wherein said introducing results in editing of the target DNA thereby producing the genetically modified cell.

2. The method of claim 1, wherein the target DNA is chromosomal DNA.

3. The method of claim 1, wherein the double molecule DNA-targeting RNA is introduced into the target cell by introducing the activator-RNA and the targeter-RNA into the target cell as RNAs.

4. The method of claim 1, wherein the method further comprises introducing a donor polynucleotide into the target cell and a sequence of the donor polynucleotide is integrated into the target DNA.

5. The method of claim 1, wherein the Cas9 protein is fused to a heterologous protein.

6. The method of claim 5, wherein the heterologous protein has DNA modifying activity.

7. The method of claim 1, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain.

8. The method of claim 1, wherein the method comprises introducing into the cell two or more different targeter-RNAs that hybridize to different target sequences.

9. The method of claim 1, wherein the activator-RNA and/or the targeter-RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

10. The method of claim 9, wherein the activator-RNA and/or the targeter-RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.

11. The method of claim 1, wherein the activator-RNA and/or the targeter-RNA comprises one or more of:

a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′

-substituted sugar moiety, a 2′

-O-methoxyethyl modified sugar moiety, a 2′

-O-methyl modified sugar moiety, a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-fluoro modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

12. The method of claim 1, wherein the activator-RNA and/or the targeter-RNA comprises comprises a heterologous moiety.

13. The method of claim 1, wherein the activator-RNA and/or the targeter-RNA comprises one or more of the following heterologous moieties:

a polyamine;

a polyamide;

a polyethylene glycol;

a polyether;

a cholesterol moiety;

a cholic acid;

a thioester;

a thiocholesterol;

a lipid;

an aliphatic chain;

a phospholipid;

an adamantane acetic acid;

a palmityl moiety;

an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety;

a biotin;

a phenazine;

a folate;

a phenanthridine;

an anthraquinone;

an acridine;

a fluorescein;

a rhodamine;

a coumarin; and

a dye.

14. The method of claim 1, wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO:

432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO;

     397).

15. The method of claim 1, wherein the cell is a bacterial cell.

16. A method of making a genetically modified cell, comprising:

contacting a population of target cells with;

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a double molecule DNA-targeting RNA or one or more nucleic acids encoding the double molecule DNA-targeting RNA, wherein the double molecule DNA-targeting RNA comprises;

(i) a targeter-RNA that comprises;

a first nucleotide sequence that is complementary to and hybridizes with a 15 to 25 nucleotide long target sequence of a target DNA inside of one or more target cells of said population of target cells, and

a second nucleotide sequence that hybridizes with an activator-RNA to form a double-stranded RNA duplex, wherein the first and second nucleotide sequences are heterologous to one another, and

(ii) the activator-RNA,

wherein the second nucleotide sequence of the targeter-RNA hybridizes with the activator-RNA to form a total of 8 to 15 base pairs,

wherein said contacting results in editing of the target DNA inside of one or more target cells of said population of target cells, thereby producing one or more genetically modified cells.

17. The method of claim 16, wherein the method further comprises, after said contacting, culturing said one or more genetically modified cells to produce a population of cells.

18. The method of claim 16, wherein the target DNA is chromosomal DNA.

19. The method of claim 16, wherein the method further comprises contacting the population of target cells with a donor polynucleotide and a sequence of the donor polynucleotide is integrated into the target DNA inside of said one or more target cells of said population of target cells.

20. The method of claim 16, wherein the Cas9 protein is fused to a heterologous protein.

21. The method of claim 20, wherein the heterologous protein has DNA modifying activity.

22. The method of claim 16, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain.

23. The method of claim 16, wherein the method comprises contacting the population of target cells with two or more different targeter-RNAs that hybridize to different target sequences.

24. The method of claim 16, wherein the activator-RNA and/or the targeter-RNA comprises one or more of:

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

25. The method of claim 24, wherein the activator-RNA and/or the targeter-RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.

26. The method of claim 16, wherein the activator-RNA and/or the targeter-RNA comprises one or more of:

a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′

-substituted sugar moiety, a 2′

-O-methoxyethyl modified sugar moiety, a 2′

-O-methyl modified sugar moiety, a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-fluoro modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

27. The method of claim 16, wherein the activator-RNA and/or the targeter-RNA comprises comprises a heterologous moiety.

28. The method of claim 16, wherein the activator-RNA and/or the targeter-RNA comprises one or more of the following heterologous moieties:

a polyamine;

a polyamide;

a polyethylene glycol;

a polyether;

a cholesterol moiety;

a cholic acid;

a thioester;

a thiocholesterol;

a lipid;

an aliphatic chain;

a phospholipid;

an adamantane acetic acid;

a palmityl moiety;

an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety;

a biotin;

a phenazine;

a folate;

a phenanthridine;

an anthraquinone;

an acridine;

a fluorescein;

a rhodamine;

a coumarin; and

a dye.

29. The method of claim 16, wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO:

432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO;

     397).

30. The method of claim 16, wherein the population of target cells is a population of bacterial cells.