Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

• US 10,640,791 B2
• Filed: 02/14/2019
• Issued: 05/05/2020
• Est. Priority Date: 05/25/2012
• Status: Active Grant

• Current Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Original Assignee: Regents of the University of California (University of California)
• Inventors: Doudna, Jennifer A., Jinek, Martin, Chylinski, Krzysztof, Charpentier, Emmanuelle
• Primary Examiner(s): Hammell, Neil P
• Application Number:
  US16/276,352
• Publication Number:
  US 20190169643A1
• Time in Patent Office: 446 Days
• Field of Search: None
• CPC Class Codes: A01H 6/4684 Zea mays [maize]
• CPC Class Codes: A01K 67/027 New or modified breeds of vertebrates
• CPC Class Codes: A61K 38/465 acting on ester bonds (3.1), e.g. lipases, ribonucleases
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/746 for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/902 using homologous recombination
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/13 Decoys
• CPC Class Codes: C12N 2310/14 : interfering N.A.
• CPC Class Codes: C12N 2310/20 : involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/32 : of the sugar
• CPC Class Codes: C12N 2310/33 : of the base
• CPC Class Codes: C12N 2310/3519 : Fusion with another nucleic acid
• CPC Class Codes: C12N 2310/531 : Stem-loop; Hairpin
• CPC Class Codes: C12N 2800/80 : Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/22 : Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Q 1/686 : Polymerase chain reaction [PCR]
• CPC Class Codes: C12Y 301/04 : Phosphoric diester hydrolases (3.1.4)
• CPC Class Codes: H01L 21/02312 : treatment by exposure to a gas or vapour
• CPC Class Codes: H01L 21/02365 : Forming inorganic semiconducting materials on a substrate for light-sensitive devices H01L31/00
• CPC Class Codes: H01L 33/0075 : comprising nitride compounds
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

1. A method of targeting and binding a target DNA in a prokaryotic cell, the method comprising:

contacting the target DNA inside of the prokaryotic cell with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, and wherein the activator-RNA;

(1) comprises one or more of;

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase, and/or (2) comprises a heterologous moiety,

wherein the complex binds to the target DNA.

2. The method of claim 1, wherein the prokaryotic cell is a bacterial cell.

3. The method of claim 1, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.

4. The method of claim 1, wherein the Cas9 protein is fused to a heterologous polypeptide.

5. The method of claim 1, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of:

a protein tag, an IF2 domain, a GST domain, a GRPE domain, a 6×

His tag, a hemagglutinin (HA) tag, and green fluorescent protein.

6. The method of claim 1, wherein the activator-RNA comprises the nucleic acid mimetic.

7. The method of claim 1, wherein the activator-RNA comprises one or more of:

(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage,

(2) the modified sugar moiety, which comprises a locked nucleic acid (LNA) sugar moiety, a 2′

-substituted sugar moiety, a 2′

-O-methoxyethyl modified sugar moiety, a 2′

-O-methyl modified sugar moiety, a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-fluoro modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, or a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, and

(3) the nucleic acid mimetic, which comprises a peptide nucleic acid (PNA), a morpholino nucleic acid, or a cyclohexenyl nucleic acid (CeNA).

8. The method of claim 1 wherein the activator-RNA comprises the non-natural internucleoside linkage and the modified sugar moiety.

9. The method of claim 1, wherein the activator-RNA comprises the heterologous moiety.

10. The method of claim 9, wherein the heterologous moiety is one or more of the following:

a polyamine;

an acridine;

a fluorescein;

a rhodamine;

a coumarin; and

a dye.

11. The method of claim 1, wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.

12. The method of claim 1, wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO:

432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO;

     397).

13. The method of claim 1, wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.

14. The method of claim 1, wherein said contacting comprises introducing the Cas9 protein, an RNA molecule that encodes the Cas9 protein, or a DNA molecule that encodes the Cas9 protein into the prokaryotic cell.

15. The method of claim 1, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

16. A method of cleaving a target DNA in a prokaryotic cell, the method comprising:

contacting the target DNA inside of the prokaryotic cell with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, and wherein the activator-RNA;

(1) comprises one or more of;

a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase, and/or (2) comprises a heterologous moiety,

wherein said contacting results in cleavage of the target DNA.

17. The method of claim 16, wherein the prokaryotic cell is a bacterial cell.

18. The method of claim 16, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.

19. The method of claim 16, wherein the Cas9 protein is fused to a heterologous polypeptide.

20. The method of claim 16, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of:

a protein tag, an IF2 domain, a GST domain, a GRPE domain, a 6×

His tag, a hemagglutinin (HA) tag, and green fluorescent protein.

21. The method of claim 16, wherein the activator-RNA comprises one or more of:

(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage,

(2) the modified sugar moiety, which comprises a locked nucleic acid (LNA) sugar moiety, a 2′

-substituted sugar moiety, a 2′

-O-methoxyethyl modified sugar moiety, a 2′

-O-methyl modified sugar moiety, a 2′

-O-(2-methoxyethyl) modified sugar moiety, a 2′

-fluoro modified sugar moiety, a 2′

-dimethylaminooxyethoxy modified sugar moiety, or a 2′

-dimethylaminoethoxyethoxy modified sugar moiety, and

(3) the nucleic acid mimetic, which comprises a peptide nucleic acid (PNA), a morpholino nucleic acid, or a cyclohexenyl nucleic acid (CeNA).

22. The method of claim 16, wherein the activator-RNA comprises Hall the non-natural internucleoside linkage and the modified sugar moiety.

23. The method of claim 16, wherein the activator-RNA comprises said heterologous moiety, which is one or more of the following heterologous moieties:

an acridine;

a fluorescein;

a rhodamine;

a coumarin; and

a dye.

24. The method of claim 16, wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.

25. The method of claim 16, wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO:

432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO;

     397).

26. The method of claim 16, wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.

27. The method of claim 16, wherein said contacting comprises introducing the Cas9 protein, an RNA molecule that encodes the Cas9 protein, or a DNA molecule that encodes the Cas9 protein into the prokaryotic cell.

28. The method of claim 16, wherein the method comprises introducing a donor polynucleotide into the prokaryotic cell.

29. The method of claim 16, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

30. A method of targeting and binding a target DNA in a prokaryotic cell, the method comprising:

contacting the target DNA inside of the prokaryotic cell with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the activator-RNA and the targeter-RNA are conjugated to a heterologous moiety,

wherein said contacting results in modification of the target DNA.

31. A method of targeting and binding a target DNA, the method comprising:

contacting a target DNA in a prokaryotic cell with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising;

a first nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, and a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and

(ii) the activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the complex binds to the target DNA.

32. The method of claim 31, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.

33. The method of claim 31, wherein the Cas9 protein is fused to a heterologous polypeptide.

34. The method of claim 31, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of:

a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×

His tag, a hemagglutinin (HA) tag, and green fluorescent protein.

35. The method of claim 31, wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.

36. The method of claim 31, wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.

37. A method of modifying a target DNA, the method comprising:

contacting a target DNA in a prokaryotic cell with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising;

a first nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, and a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and

(ii) the activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein said contacting results in modification of the target DNA.

38. The method of claim 37, wherein said modification is cleavage of the target DNA.

39. The method of claim 38, wherein a nucleotide sequence of a donor polynucleotide is integrated into the target DNA.

40. The method of claim 37, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.

41. The method of claim 37, wherein the Cas9 protein is fused to a heterologous polypeptide.

42. The method of claim 37, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of:

a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×

His tag, a hemagglutinin (HA) tag, and green fluorescent protein.

43. The method of claim 37, wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.

44. The method of claim 37, wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.

45. The method of claim 37, wherein said contacting comprises introducing the Cas9 protein into the prokaryotic cell as protein.

46. The method of claim 37, wherein contacting comprises introducing a nucleic acid that encodes the Cas9 protein into the prokaryotic cell.

47. The method of claim 37, wherein said contacting comprises introducing a nucleic acid encoding the Cas9 protein into the prokaryotic cell, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

48. The method of claim 37, wherein the prokaryotic cell is a bacterial cell.