Innate immunity-stimulating compositions of CpG and saponin and methods thereof

US 20010034330A1
Filed: 01/12/2001
Published: 10/25/2001
Est. Priority Date: 08/10/1998
Status: Abandoned Application

First Claim

Patent Images

1. A composition comprising:

(a) a saponin; and

(b) an oligonucleotide comprising at least one unmethylated CpG dinucleotide.

View all claims

2 Assignments

Timeline View

Assignment View

0 Petitions

Accused Products

Abstract

Compositions comprising oligonucleotides comprising at least one unmethylated CpG dinucleotide and saponin and the use thereof for stimulating innate immunity and enhancing natural killer cell activity are disclosed.

73 Citations

View as Search Results

43 Claims

1. A composition comprising:
- (a) a saponin; and
  
  (b) an oligonucleotide comprising at least one unmethylated CpG dinucleotide.
- View Dependent Claims (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 42, 43)
- - 2. The composition as claimed in claim 1, wherein the saponin is derived from Quillaja saponaria.
  - 3. The composition as claimed in claim 2, wherein the saponin is chemically modified.
  - 4. The composition as claimed in claim 2, wherein the saponin comprises a substantially pure saponin.
  - 5. The composition as claimed in claim 4, wherein the substantially pure saponin comprises QS-7, QS-17, QS-18, or QS-21.
  - 6. The composition as claimed in claim 5, wherein the substantially pure saponin comprises QS-21.
  - 7. The composition as claimed in claim 1, wherein the oligonucleotide is chemically modified.
  - 8. The composition as claimed in claim 7, wherein the oligonucleotide is modified with at least one phosphorothioate internucleotide linkage.
  - 9. The composition as claimed in claim 1, wherein the oligonucleotide comprises a CpG motif having the formula 5′
    - X₁CGX₂3′
      
      , wherein at least one nucleotide separates consecutive CpGs, and wherein X₁is adenine, guanine, or thymine, and X₂is cytosine, thymine, or adenine.
  - 10. The composition as claimed in claim 9, wherein the CpG motif comprises TCCATGACGTTCCTGACGTT or TCGTCGTTTTGTCGTTTTGTCGTT.
  - 11. The composition as claimed in claim 1, wherein the composition increases an innate immune response when administered to a mammal.
  - 12. The composition as claimed in claim 1, wherein the composition increases an innate immune response when administered to a human.
  - 13. The composition as claimed in claim 1, wherein the composition increases an innate immune response when administered to a mammal other than a human.
  - 14. The composition as claimed in claim 11, wherein the composition further enhances a natural killer cell response.
  - 15. The composition as claimed in claim 14, wherein the composition further enhances a natural killer cell response in a positive synergistic manner.
  - 42. The composition as claimed in claim 12, wherein the composition further enhances a natural killer cell response.
  - 43. The composition as claimed in claim 13, wherein the composition further enhances a natural killer cell response.

16. A method for stimulating innate immunity comprising administering an effective amount of a composition comprising:
- (a) a saponin; and
  
  (b) an oligonucleotide comprising at least one unmethylated CpG motif to an individual.
- View Dependent Claims (17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30)
- - 17. The method as claimed in claim 16, wherein the saponin is derived from Quillaja saponaria.
  - 18. The method as claimed in claim 16, wherein the saponin is chemically modified.
  - 19. The method as claimed in claim 17, wherein the saponin comprises a substantially pure saponin.
  - 20. The method as claimed in claim 19, wherein the substantially pure saponin comprises QS-7, QS-17, QS-18, or QS-21.
  - 21. The method as claimed in claim 20, wherein the substantially pure saponin comprises QS-21.
  - 22. The method as claimed in claim 16, wherein the oligonucleotide is chemically modified.
  - 23. The method as claimed in claim 22, wherein the oligonucleotide is modified with at least one phosphorothioate internucleotide linkage.
  - 24. The method as claimed in claim 16, wherein the oligonucleotide comprises a CpG motif having the formula 5′
    - X₁,CGX₂3′
      
      , wherein at least one nucleotide separates consecutive CpGs, and wherein X₁is adenine, guanine, or thymine, and X₂is cytosine, thymine, or adenine.
  - 25. The method as claimed in claim 24, wherein the CpG motif comprises TCCATGACGTTCCTGACGTT or TCGTCGTTTTGTCGTTTTGTCGTT.
  - 26. The method as claimed in claim 16, wherein the composition stimulates an innate immune response when administered to a mammal.
  - 27. The method as claimed in claim 16, wherein the composition stimulates an innate immune response when administered to a human.
  - 28. The method as claimed in claim 16, wherein the composition stimulates an innate immune response when administered to a mammal other than a human.
  - 29. The method as claimed in claim 16, wherein the method further enhances a natural killer cell response.
  - 30. The method as claimed in claim 16, wherein the method further enhances a natural killer cell response in a positive synergistic manner.

31. A method for stimulating innate immunity comprising administering an effective amount of a composition comprising a saponin to an individual.
- View Dependent Claims (32, 33, 34, 35, 36, 37, 38, 39, 40, 41)
- - 32. The method as claimed in claim 31, wherein the saponin is derived from Quillaja saponaria.
  - 33. The method as claimed in claim 32, wherein the saponin is modified.
  - 34. The method as claimed in claim 32, wherein the saponin comprises a substantially pure saponin.
  - 35. The method as claimed in claim 34, wherein the substantially pure saponin comprises QS-7, QS-17, QS-18, or QS-21.
  - 36. The method as claimed in claim 35, wherein the substantially pure saponin comprises QS-21.
  - 37. The method as claimed in claim 32, wherein the composition stimulates an innate immune response when administered to a mammal.
  - 38. The method as claimed in claim 32, wherein the composition stimulates an innate immune response when administered to a human.
  - 39. The method as claimed in claim 32, wherein the composition stimulates an innate immune response when administered to a mammal other than a human.
  - 40. The method as claimed in claim 32, wherein the method further enhances a natural killer cell response.
  - 41. The method as claimed in claim 40, wherein the method further enhances a natural killer cell response in a positive synergistic manner.

Specification

Resources

Litigation Campaign Assessment

Current Assignee
Antigenics Inc. (Agenus Inc.)
Original Assignee
Antigenics Inc. (Agenus Inc.)
Inventors
Kensil, Charlotte

Application Number

US09/760,506
Publication Number

US 20010034330A1
Time in Patent Office

Days
Field of Search
US Class Current

514/44
CPC Class Codes

A61K 2039/55561   CpG containing adjuvants; O...

A61K 2039/55577   Saponins; Quil A; QS21; ISCOMS

A61K 2300/00   Mixtures or combinations of...

A61K 31/7088   Compounds having three or m...

A61K 36/73   Rosaceae (Rose family), e.g...

A61K 39/39   characterised by the immuno...

Innate immunity-stimulating compositions of CpG and saponin and methods thereof

First Claim

2 Assignments

0 Petitions

Accused Products

Abstract

73 Citations

43 Claims

Specification

Solutions

Use Cases

Quick Links

Innate immunity-stimulating compositions of CpG and saponin and methods thereof

First Claim

2 Assignments

Subscription Required

Subscription Required

0 Petitions

Subscription Required

Accused Products

Subscription Required

Abstract

73 Citations

43 Claims

Specification

Subscription Required

Solutions

Use Cases

Quick Links