Method of treating hepatitis delta virus infection

• US 20030158149A1
• Filed: 11/22/2002
• Published: 08/21/2003
• Est. Priority Date: 03/29/2000
• Status: Active Grant

• Current Assignee: Brent E. Korba, Bud C. Tennant, Chung K. Chu, John L. Casey, John L. Gerin, Paul J. Cote
• Original Assignee: Brent E. Korba, Bud C. Tennant, Chung K. Chu, John L. Casey, John L. Gerin, Paul J. Cote
• Inventors: Chu, Chung K., Korba, Brent E., Gerin, John L., Tennant, Bud C., Cote, Paul J., Casey, John L.
• Granted Patent: US 7,511,027 B2
• Time in Patent Office: Days
• US Class Current: 514/49
• CPC Class Codes: A61K 31/7072 having two oxo groups directly attached to the pyrimidine ring, e.g. uridine, uridylic acid, thymidine, zidovudine
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: A61K 45/06 Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• CPC Class Codes: A61P 1/16 for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• CPC Class Codes: A61P 31/14 for RNA viruses
• CPC Class Codes: A61P 31/20 for DNA viruses
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/1131 against viruses
• CPC Class Codes: C12N 2310/3125 Methylphosphonates
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: G01N 33/5765 Hepatitis delta antigen

Abstract

A method for the treatment for hepatitis delta infection in a host, that includes administering an effective amount of a nucleoside or a nucleoside analog that suppresses the expression of the hepatitis B surface or preS1 antigen in the host 100-fold or more relative to pretreatment values in vivo; or to not more than 1 microgram per milliliter in vivo. In a preferred embodiment, the nucleoside is L-FMAU, or a pharmaceutically acceptable salt or prodrug thereof.

Claims

1. A method for the treatment of hepatitis delta infection comprising administering to a host infected with hepatitis delta virus an effective amount of a nucleoside or nucleoside analog compound, or a pharmaceutically acceptable salt or prodrug thereof, that reduces the level of hepatitis B surface or preS1 antigen in the host 100-fold or more relative to pretreatment value.

2. The method of treatment of claim 1, wherein the compound is of the formula

3. The method of claim 2, wherein the compound is 2′

-fluoro-5-methyl-β

-L-arabinofuranosyl-uridine, or its pharmaceutically acceptable salt or prodrug.

4. The method of claim 3, wherein the compound is administered in an enantiomerically enriched form.

17. The method of claim 1, further comprising administering the compound in combination or alternation with other agents that reduce the level of hepatitis B surface or preS1 antigen in the host, or which are known to otherwise treat hepatitis delta infection.

18. The method of claim 17, wherein the agent is selected from the group consisting of a ribozyme, a cytokine including interleukin, interferon, an antibody to hepatitis B surface antigen or a transcriptional factor or other mediator of hepatitis B surface antigen expression;

hepatitis B surface antigen or a transcriptional factor or other mediator of hepatitis B surface antigen expression;

a protein-prenyl transferase inhibitor or thymosin-alpha-1.

19. The method of claim 18, wherein the agent is an antisense oligonucleotide that inhibits the expression of hepatitis B surface antigen or preS1 antigen.

20. The method of claim 19, wherein the antisense oligonucleotide has a sequence selected from the group consisting of SEQ ID NO.:

1, SEQ ID NO.;

2, SEQ ID NO.;

3, SEQ ID NO.;

4, SEQ ID NO.;

5, SEQ ID NO.;

6, SEQ ID NO.;

7, SEQ ID NO.;

8, SEQ ID NO.;

9, SEQ ID NO.;

10, SEQ ID NO.;

11, SEQ ID NO.;

12, SEQ ID NO.;

13, SEQ ID NO.;

14, SEQ ID NO.;

15, SEQ ID NO.;

16, SEQ ID NO.;

17, SEQ ID NO.;

18, SEQ ID NO.;

19, and SEQ ID NO.;

20.

5. A method for the treatment of hepatitis delta infection comprising:

administering to a host infected with hepatitis delta virus an effective amount of a nucleoside or nucleoside analog compound, or a pharmaceutically acceptable salt or prodrug thereof, that reduces the level of preS1 antigen in the host 100-fold or more relative to pretreatment value.

6. A method for the treatment of HDV infected host comprising administering of an effective amount of a nucleoside or nucleoside analog that reduces HBsAg in the infected host to not more than approximately 1 microgram per milliliter, as measured in serum or plasma.

7. A method for the treatment of an HDV infected host comprising administering an effective amount of an organic non-nucleoside small molecule of molecular weight less than 500, and which is not (i) a biologic material found in nature or a derivative thereof retaining the desired activity comprising a protein, antibody, hormone, ribozyme, nucleic acid, protein, or cytokine;

or (ii) not a protein-prenyl transferase inhibitor or thymosin-alpha-1;

that that reduces HBsAg in the infected host to at least approximately 100-fold or more or that reduces HBsAg in an infected host to not more than approximately 1 microgram per milliliter, as measured in serum or plasma.

8. A method for the treatment of an HDV infected host comprising administering an effective amount of an organic non-nucleoside small molecule of molecular weight less than 500, and which is not (i) a biologic material found in nature or a derivative thereof retaining the desired activity comprising a protein, antibody, hormone, ribozyme, nucleic acid, protein, or cytokine;

or (ii) not a protein-prenyl transferase inhibitor or thymosin-alpha-1;

that that reduces preS1 antigen in the infected host to at least approximately 100-fold or more.

9. A method for screening a compound that is effective in the treatment of HDV infection comprising assessing whether the compound suppresses the expression of hepatitis B surface antigen 100-fold or more relative to pretreatment values in vivo or in vitro, or to not more than 1 microgram per milliliter, as measured in serum or plasma.

10. A method for screening a compound that is effective in the treatment of HDV infection comprising assessing whether the compound suppresses the expression of preS1 antigen 100-fold or more relative to pretreatment values in vivo or in vitro

11. A method for treating HDV infection comprising administering at least one antisense oligonucleotide targeted to the hepatitis B surface preS1 antigen.

12. The method of claim 11, wherein the antisense oligonucleotide is selected from the group consisting of (SEQ ID NO.:

1) CTTAGGACTACACTACAAGAG;

(SEQ ID NO.;

     2) GACTACACTACAAGAG;

(SEQ ID NO.;

     3) AGGACTACACTACAAGAGGTA;

(SEQ ID NO.;

     4) TACACTACAAGAGGTA;

(SEQ ID NO.;

     5) TCTTCCCCAGGATCCT;

(SEQ ID NO.;

     6) TTTGGGGCGGACATTG;

(SEQ ID NO.;

     7) CCTAAGAACAGTTGTT;

(SEQ ID NO.;

     8) GTACAAGTCGCGTCCCAGG;

(SEQ ID NO.;

     9) TAGGAGCTCTTCTAAC;

(SEQ ID NO.;

     10) TATTCCCTAGTCTTGT;

(SEQ ID NO.;

     11) CAAGAGGTACAAGTC;

(SEQ ID NO.;

     12) CGACCACCTTTCTAAGACGGG;

(SEQ ID NO.;

     13) CCTTTCTAAGACGGG;

(SEQ ID NO.;

     14) TAAGACGGGGTA;

(SEQ ID NO.;

     15) GACGGGGTACGACAT; and

(SEQ ID NO.;

     16) GTACGACATCTAGAA

13. The method of claim 11, wherein the antisense sequence is selected from the group consisting of (SEQ ID NO.:

17) CCTGATGTGATGTTCTCCAT;

(SEQ ID NO.;

     18) GAACTGGAGCCACCAGCAGG;

(SEQ ID NO.;

     19) GAAAGATTCGTCCCCATGC; and

(SEQ ID NO.;

     20) CCACTGCATGGCCTGAGGATG.

14. A method of identifying a compound, including a nucleoside or nucleoside analog, that is effective in the treatment of HDV infection, comprising the steps of:

a) administering a test compound to a woodchuck chronically infected with woodchuck hepatitis virus and also infected with a woodchuck-adapted HDV inoculum;

b) monitoring the levels of hepatitis surface antigen expressed in the animal treated with the test compound;

c) comparing the levels of hepatitis surface antigen in animals treated with the test compound to control animals not treated with the test compound;

d) selecting the compound in step (c) wherein the levels of hepatitis surface antigen are significantly lower that the levels of hepatitis surface antigen in animals not treated with the test compound, and in a preferred embodiment, not higher than 1 microgram/milliliter in serum.

15. The method of claim 14, wherein there is a concurrent reduction in the levels of hepatitis surface antigen and hepatitis D RNA in animals treated with the test compound.

16. A method of identifying a compound, including a nucleoside or nucleoside analog, that is effective in the treatment of HDV infection, comprising the steps of:

a) administering a test compound to an in vitro cell that has been transfected with human hepatitis B virus, such as 2.2.15 cells;

b) monitoring the levels of hepatitis surface antigen expressed in the cell treated with the test compound;

c) comparing the levels of hepatitis surface antigen in animals treated with the test compound to control animals not treated with the test compound;

d) selecting the compound in step (c) wherein the levels of hepatitis surface antigen are significantly lower that the levels of hepatitis surface antigen not treated with the test compound, and in a preferred embodiment, 100-fold or more relative to a control.

21. A method of identifying a compound, including a nucleoside or nucleoside analog, that is effective in the treatment of HDV infection, comprising the steps of :

a) administering a test compound to an in vitro cell that has been transfected in order to express both hepatitis B surface or preS1 antigen and hepatitis delta;

b) monitoring the levels of hepatitis B surface antigen or preS1 antigen and hepatitis delta virus expressed intracellularly and secreted into the media of cells treated with the test compound;

c) comparing the levels of hepatitis B surface or preS1 antigen and hepatitis delta virus secreted from cells treated with the test compound to control cells not treated with the test compound;

d) selecting the compound in step (c) wherein the secreted levels of hepatitis surface antigen or preS1 antigen and hepatitis delta virus are significantly lower than the levels of hepatitis B surface antigen secreted from cells not treated with the compound.