Antisense oligonucleotides that inhibit expression of HIF-1

• US 20040152655A1
• Filed: 01/28/2004
• Published: 08/05/2004
• Est. Priority Date: 01/31/2003
• Status: Active Grant

• Current Assignee: Ocuphire Pharma, Inc.
• Original Assignee: Rexahn Pharmaceuticals, Inc.
• Inventors: Jiang, Xiaoming, Lee, Young Bok, Yoon, Heejeong, Mao, Lingjun, Ahn, Chang-Ho
• Granted Patent: US 7,205,283 B2
• Time in Patent Office: Days
• US Class Current: 514/44
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: C07H 21/04 with deoxyribosyl as saccharide radical
• CPC Class Codes: C12N 15/1137 against enzymes viral enzymes C12N15/1131; receptors C12N15/1138
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: C12Q 1/6886 for cancer immunoassay for cancer G01N33/574

Abstract

New antisense oligonucleotide compounds, RX-0047 and RX-0149, inhibit expression of HIF-1 and also induce cytotoxicity in several cancer cell lines.

Claims

1. A compound, RX-0047, having a sequence comprising Seq. Id. No. 2 5′

aatgagccaccagtgtccaa 3′

, targeted to a nucleic acid molecule encoding human HIF-1, wherein said oligonucleotide compound inhibits the expression of human HIF-1.

2. The compound of claim 1, wherein the compound is an antisense oligonucleotide.

3. The antisense oligonucleotide of claim 2 having at least one modified internucleoside linkage that is a phosphorothioate linkage.

4. A method of inhibiting the expression HIF-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 1.

5. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human HIF-1 sequence, comprising, RX-0047, Seq. Id. No. 2, 5′

aatgagccaccagtgtccaa 3′

.

6. A compound, RX-0149, 5′

ggagctaacatctccaagtc 3′

, Seq. Id. No. 4, targeted to a nucleic acid molecule encoding HIF-1, wherein said compound inhibits the expression of human HIF-1.

7. The compound of claim 6, wherein the compound is an antisense oligonucleotide.

8. The antisense oligonucleotide of claim 7 having at least one modified internucleoside linkage that is a phosphorothioate linkage.

9. A method of inhibiting the expression of HIF-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 6.

10. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human HIF-1 sequence, comprising Seq. Id. No. 4 RX-0149, 5′

ggagctaacatctccaagtc 3′

.