Methods and apparatus for sample tracking
First Claim
1. A method for identifying a biological sample comprising biological material of a mammal, which comprises the steps of:
- a) obtaining amplification data indicative of amplification of at least two DNA markers of genomic DNA of the mammal;
b) generating indicia indicative of the amplification data; and
c) associating the indicia with the biological sample, whereby the indicia may be used to identify the biological sample.
2 Assignments
0 Petitions
Accused Products
Abstract
A method and apparatus are provided for identifying a biological sample obtained during either paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, diagnosis to detect the presence of a target microorganism carrier detection analysis, forensic chemical analysis, or diagnosis of a subject to determine whether a subject is afflicted with a particular disease or disorder, or is at risk of developing a particular disorder, wherein the result obtained from the analysis is associated with the unique DNA fingerprint biological barcode of the genotype of the subject being analyzed. The methods and apparatus of the invention have application in the fields of diagnostic medicine, disease diagnosis in animals and plants, identification of genetically inherited diseases in humans, family relationship analysis, forensic analysis, and microbial typing.
120 Citations
38 Claims
-
1. A method for identifying a biological sample comprising biological material of a mammal, which comprises the steps of:
-
a) obtaining amplification data indicative of amplification of at least two DNA markers of genomic DNA of the mammal;
b) generating indicia indicative of the amplification data; and
c) associating the indicia with the biological sample, whereby the indicia may be used to identify the biological sample. - View Dependent Claims (2, 3, 4, 5, 6, 7, 8, 9, 10, 11)
-
-
12. A method for creating a database, the database comprising a plurality of locations, the method comprising:
-
for each of a plurality of mammals;
a) obtaining amplification data indicative of amplification of at least two DNA markers of genomic DNA of the mammal;
b) entering the amplification data in a first location of the database; and
c) entering first indicia in a second location of the database, the first indicia indicative of an identity of the mammal, wherein the first and second locations are related, whereby the database may be searched using one of the amplification data or first indicia to determine the other of the amplification data or first indicia. - View Dependent Claims (13, 14, 15, 16, 17)
-
-
18. A sample tracking system, comprising:
-
a) a device configured to at least;
obtain amplification data indicative of amplification of at least two DNA markers of genomic DNA of a mammal;
b) a processor configured to at least;
generate indicia indicative of the amplification data; and
associate the indicia with the biological sample, whereby the indicia may be used to identify the biological sample. - View Dependent Claims (19, 20, 21, 22, 23, 24)
-
-
25. A method for identifying a biological sample of a mammal, which comprises the steps of:
-
a) obtaining a genomic DNA sample from said mammal;
b) amplifying the genomic DNA sample using at least two primers for amplification of at least two DNA markers; and
c) identifying the amplified DNA markers from step b), wherein the genomic DNA sample'"'"'s unique combination of amplified markers represents the molecular barcode for identification of the biological sample.
-
-
26. A method for identification of a biological sample of a mammal, which comprises the steps of:
-
a) obtaining a genomic DNA sample from said mammal;
b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers, wherein said DNA marker amplification primers are selected from the group consisting of the following primer pairs;
D3S1358 5′
Primer ACTGCAGTCCAATCTGGGT(SEQ ID NO;
1)3′
primer ATGAAATCAACAGAGGCTTG;(SEQ ID NO;
2)D5S818 5′
Primer GGGTGATTTTCCTCTTTGGT(SEQ ID NO;
3)3′
primer TGATTCCAATCATAGCCACA;(SEQ ID NO;
4)D7S820 5′
Primer TGTCATAGTTTAGAACGAACTAACG(SEQ ID NO;
5)3′
primer CTGAGGTATCAAAAACTCAGAGG;(SEQ ID NO;
6)D13S317 5′
Primer ACAGAAGTCTGGGATGTGGA(SEQ ID NO;
7)3′
primer GCCCAAAAAGACAGACAGAA;(SEQ ID NO;
8)and D16S539 5′
Primer GATCCCAAGCTCTTCCTCTT(SEQ ID NO;
9)3′
primer ACGTTTGTGTGTGCATCTGT;(SEQ ID NO;
10)and complementary sequences thereto; and c) identifying the amplified DNA markers from step b), wherein the genomic DNA sample'"'"'s unique combination of amplified markers represents the molecular barcode for identification of the biological sample.
-
-
27. A method for identification of a biological sample of a subject undergoing diagnosis to determine whether the subject is afflicted with a particular disease or disorder, or is at risk of developing a particular disorder comprising
a) obtaining a genomic DNA sample from a subject; -
b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers;
c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample'"'"'s unique combination of amplified markers represents the molecular barcode for identification of the biological sample; and
d) performing diagnosis of the subject'"'"'s genomic DNA sample to determine whether the subject is afflicted with a particular disease or disorder, or is at risk of developing a particular disease or disorder, wherein the result obtained from said diagnosis step is thereby intimately associated with the molecular barcode of the sample of the subject being diagnosed.
-
-
28. A method for identification of a biological sample of a subject undergoing screening for genetic lesions or mutations to determine if the subject with a lesioned gene is at risk for a disease or disorder characterized by aberrant expression or activity of a given polypeptide comprising
a) obtaining a genomic DNA sample from a subject; -
b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers;
c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample'"'"'s unique combination of amplified markers represents the molecular barcode for identification of the biological sample;
d) performing screening of the subject'"'"'s genomic DNA sample for detection of genetic lesions or mutations in said genomic DNA sample to determine if a subject with a lesioned gene is at risk for a disease or disorder characterized by aberrant expression or activity of a given polypeptide;
wherein the result obtained from said screening step is thereby intimately associated with the molecular barcode of the sample of the subject being screened.
-
-
29. A method for identification of a biological sample of a subject being diagnosed for the presence of a target microorganism comprising
a) obtaining a genomic DNA sample from a subject; -
b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers; and
c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample'"'"'s unique combination of amplified markers represents the molecular barcode for identification of the biological sample; and
d) performing diagnosis of said subject to detect the presence of a target microorganism;
wherein the result obtained from said diagnosis step is thereby intimately associated with the molecular barcode of the sample of the subject being diagnosed. - View Dependent Claims (31, 32, 33, 34, 35)
-
-
30. A method for identification of a biological sample of a subject undergoing paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, disease carrier detection, or forensic chemical analysis comprising
a) obtaining a genomic DNA sample from a subject; -
b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers;
c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample'"'"'s unique combination of amplified markers represents the molecular barcode for identification of the biological sample; and
d) performing paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, disease carrier detection, forensic chemical analysis, or any combination thereof, of the subject'"'"'s genomic DNA sample, wherein the result obtained from said paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, disease carrier detection, or forensic chemical analysis step is thereby intimately associated with the molecular barcode of the sample of the subject being screened or diagnosed.
-
-
36. A method for unequivocally identifying a biological sample obtained during the screening of a plant to detect the presence of a target microorganism comprising the steps of a) obtaining a biological sample from a plant;
- b) detecting the presence of a target microorganism in said biological sample; and
c) simultaneously identifying the DNA fingerprint of the biological sample, wherein the result obtained from the screening is associated with the unique DNA fingerprint biological barcode of the genotype of the plant being screened.
- b) detecting the presence of a target microorganism in said biological sample; and
-
37. A method for unequivocally identifying a biological sample obtained during carrier detection analysis or forensic chemical analysis of a plant comprising the steps of a) obtaining a biological sample from a plant;
- b) performing carrier detection analysis or forensic chemical analysis on said biological sample; and
c) simultaneously identifying the DNA fingerprint of the biological sample, wherein the result obtained from said analysis is associated with the unique DNA fingerprint biological barcode of the genotype of the plant being analyzed.
- b) performing carrier detection analysis or forensic chemical analysis on said biological sample; and
-
38. A method for unequivocally identifying a biological sample obtained during the testing of a plant to determine whether a plant is afflicted with a particular disease or condition, or is at risk of developing a particular disease or condition comprising the steps of a) obtaining a biological sample from a plant;
- b) testing a plant to determine whether a plant is afflicted with a particular disease or condition, or is at risk of developing a particular disease or condition; and
c) simultaneously identifying the DNA fingerprint of the biological sample, wherein the result obtained from the testing is associated with the unique DNA fingerprint biological barcode of the genotype of the plant being tested.
- b) testing a plant to determine whether a plant is afflicted with a particular disease or condition, or is at risk of developing a particular disease or condition; and
Specification