SNP discriminatory siRNA

• US 20050176045A1
• Filed: 01/25/2005
• Published: 08/11/2005
• Est. Priority Date: 02/06/2004
• Status: Abandoned Application

• Current Assignee: Dharmacon Incorporated (Revvity, Inc.)
• Original Assignee: Dharmacon Incorporated (Revvity, Inc.)
• Inventors: Khvorova, Anastasia, Reynolds, Angela, Fedorov, Yuriy
• Application Number:
  US11/043,637
• Publication Number:
  US 20050176045A1
• Time in Patent Office: Days
• US Class Current: 435/6
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/1135 against oncogenes or tumor suppressor genes
• CPC Class Codes: C12N 2310/14 interfering N.A.
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/322 2'-R Modification
• CPC Class Codes: C12N 2310/3521 Methyl
• CPC Class Codes: C12N 2320/11 for the determination of target sites, i.e. of active nucleic acids
• CPC Class Codes: C12N 2320/51 modulating the chemical stability, e.g. nuclease-resistance

Abstract

A method of identifying SNP specific siRNA is provided. The method comprises comparing the silencing effect of: (i) at least two SNP containing siRNA in cells that contain a SNP target sequence; (ii) said at least two SNP containing siRNA in cells that contain a wild type target sequence; (iii) at least two non-SNP containing siRNA in cells that contain a SNP target sequence; and (iv) said at least two non-SNP containing siRNA in cells that contain a wild type target sequence. Through the method, SNP specific siRNA can be selected for a diverse set of genes, including the Kras gene.

Claims

1. A method of identifying SNP specific siRNA or non-SNP containing siRNA, said method comprising:

(a) comparing the silencing effect of;

(i) at least two SNP containing siRNA in cells that contain a SNP target sequence,

(ii) said at least two SNP containing siRNA in cells that contain a wild type target sequence,

(iii) at least two non-SNP containing siRNA in cells that contain a SNP target sequence, and

(iv) said at least two non-SNP containing siRNA in cells that contain a wild type target sequence; and

(b) identifying a SNP specific siRNA that silences said SNP containing target sequence, but does not silence said wild type target sequence, or identifying a non-SNP containing siRNA that silences said wild type target sequence, but does not silence said SNP target sequence.

2. The method of claim 1, wherein said comparing of either or both of said SNP containing target sequence and said wild type sequence is measured through monitoring expression of a reporter expression construct or a target gene expressed from an expression vector.

3. A method of gene silencing comprising introducing a SNP specific siRNA that silences said SNP containing target sequence, but does not silence a wild type target sequence, wherein said SNP specific siRNA comprises a sense strand and an antisense strand that are capable of forming a duplex of 18-30 base pairs.

4. The method of claim 3, wherein said SNP specific siRNA comprises:

(a) a first 5′

terminal sense nucleotide and a second 5′

terminal sense nucleotide, wherein each of said first 5′

terminal sense nucleotide and said second 5′

terminal sense nucleotide comprises a 2′

-O-alkyl group; and

(b) a first 5′

terminal antisense nucleotide, wherein said first 5′

terminal antisense nucleotide is phosphorylated at said first 5′

terminal antisense nucleotide'"'"'s 5′

carbon position.

5. The method of claim 4, wherein said SNP specific siRNA further comprises a third 5′

terminal sense nucleotide and said third 5′

terminal sense nucleotide comprises a 2′

-O-alkyl group.

6. The method of claim 4, wherein said SNP specific siRNA further comprises a second 5′

terminal antisense nucleotide, wherein each of said first 5′

terminal antisense nucleotide and said second 5′

terminal antisense nucleotide comprises a 2′

-O-alkyl group.

7. The method of claim 6, wherein said SNP specific siRNA further comprises a third 5′

terminal antisense nucleotide and said third 5′

terminal sense nucleotide comprises a 2′

-O-alkyl group.

8. The method of claim 4, further comprising a second 5′

terminal antisense nucleotide, wherein said second 5′

terminal antisense nucleotide comprises a 2′

-O-methyl modification, and wherein said 2′

-O-alkyl group is a 2′

-O-methyl group.

9. The method of claim 4, wherein said SNP specific siRNA further comprises at least one additional 2′

-O-alkyl modification on or more Cs or Us of the sense strand.

10. The method of claim 4, wherein said SNP specific siRNA further comprises at least one fluorine modification on or more Cs or Us of the antisense strand.

11. The method of claim 6, wherein said SNP specific siRNA further comprises at least one additional 2′

-O-alkyl modification on or more Cs or Us of the sense strand.

12. The method of claim 6, wherein said SNP specific siRNA further comprises at least one Fl modification on or more Cs or Us of the antisense strand.

13. The method of claim 4, wherein said SNP containing target sequence comprises at least one base pair mismatch near the 5′

end of the antisense strand.

14. The method of claim 4, wherein said each 2′

-O-alkyl modification is a 2′

-O-methyl modification.

15. The method of claim 6, wherein said each 2′

-O-alkyl modification is a 2′

-O-methyl modification.

17. The method of claim 15, wherein said wild type siRNA comprises:

(a) a first 5′

terminal sense nucleotide and a second 5′

terminal sense nucleotide, wherein each of said first 5′

terminal sense nucleotide and said second 5′

terminal sense nucleotide comprises a 2′

-O-alkyl group; and

(b) a first 5′

terminal antisense nucleotide, wherein said first 5′

terminal antisense nucleotide is phosphorylated at said first 5′

terminal antisense nucleotide'"'"'s 5′

carbon position.

16. A method of gene silencing comprising introducing a wild type siRNA that silences a wild type containing target sequence, but does not silence a SNP specific containing target sequence, wherein said wild type siRNA comprises a sense strand and an antisense strand that are capable of forming a duplex of 18-30 base pairs.

18. The method of claim 16, wherein said wild type siRNA further comprises a third 5′

terminal sense nucleotide and said third 5′

terminal sense nucleotide comprises a 2′

-O-alkyl group.

19. The method claim 16, wherein said wild type siRNA further comprises a second 5′

terminal antisense nucleotide, wherein each of said first 5′

terminal antisense nucleotide comprising and second 5′

terminal antisense nucleotide comprises a 2′

-O-alkyl group.

20. The method of claim 16, wherein said wild type siRNA further comprises a third 5′

terminal antisense nucleotide and said third 5′

terminal antisense nucleotide comprises a 2′

-O-alkyl group.

21. The method of claim 18, wherein said wild type siRNA further comprises a third 5′

terminal antisense nucleotide and said third 5′

terminal antisense nucleotide comprises a 2′

-O-alkyl group.

22. The method of claim 16, wherein said wild type siRNA further comprises at least one additional 2′

-O-alkyl modification on or more Cs or Us of the sense strand.

23. The method of claim 16, wherein said wild type siRNA further comprises at least one Fl modification on or more Cs or Us of the antisense strand.

24. The method of claim 18, wherein said wild type siRNA further comprises at least one additional 2′

-O-alkyl modification on or more Cs or Us of the sense strand.

25. The method of claim 18, wherein said wild type siRNA further comprises at least one Fl modification on or more Cs or Us of the antisense strand.

26. The method of claim 16, wherein said SNP containing target sequence comprises at least one base pair mismatch near the 5′

end of the antisense strand.

27. The method of claim 16, wherein said each 2′

-O-alkyl modification is a 2′

-O-methyl modification.

29. The polynucleotide of claim 27, wherein said sequence is the same as SEQ. ID. No. 1.

30. A method of silencing a SNP variant of the Kras gene, said method comprising introducing the polynucleotide of claim 27 into a cell.

32. The polynucleotide of claim 30, wherein said sequence is the same as SEQ. ID. No. 2.

33. A method of silencing the wild type Kras gene, said method comprising introducing the polynucleotide of claim 30 into a cell.

28. A polynucleotide, wherein the polynucleotide comprises a region that has a sequence substantially similar to:

SEQ. ID. No. 1, GUUGGAGCUGUUGGCGUAGUU and said region forms part of a duplex that is 18-30 base pairs in length.

31. A polynucleotide, wherein the polynucleotide comprises a region that has a sequence substantially similar to SEQ. ID No. 2, GUUGGAGCUGGUGGCGUAGUU and said region forms part of a duplex that is 18-30 base pairs in length.