Nucleic acid molecules containing recombination sites and methods of using the same

• US 20050208530A1
• Filed: 12/01/2004
• Published: 09/22/2005
• Est. Priority Date: 12/01/2003
• Status: Active Grant

• Current Assignee: Life Technologies Corporation (Thermo Fisher Scientific Incorporated)
• Original Assignee: Invitrogen Corp. (Thermo Fisher Scientific Incorporated)
• Inventors: Chesnut, Jon, Leong, Louis
• Granted Patent: US 8,304,189 B2
• Time in Patent Office: Days
• US Class Current: 435/6
• CPC Class Codes: C12P 19/34 Polynucleotides, e.g. nucleic acids, oligoribonucleotides
• CPC Class Codes: C12Q 1/6858 Allele-specific amplification
• CPC Class Codes: C12Q 1/6869 Methods for sequencing
• CPC Class Codes: C12Q 1/6874 involving nucleic acid arrays, e.g. sequencing by hybridisation
• CPC Class Codes: C12Q 2521/507 Recombinase
• CPC Class Codes: C12Q 2535/101 Sanger sequencing method, i.e. oligonucleotide sequencing using primer elongation and dideoxynucleotides as chain terminators
• CPC Class Codes: C12Q 2535/125 Allele specific primer extension

Abstract

The present invention relates to the fields of biotechnology and molecular biology. In particular, the present invention relates to the construction and use of nucleic acid molecules comprising cloning sites which differ in nucleotide sequence. In particular embodiments, the present invention relates to nucleic acid molecules which contain recombination sites with different primer binding sites. These different primer binding sites may be used to sequence different ends of nucleic acid segments located between the two recombination sites.

Claims

1. A method for sequencing all or part of a nucleic acid segment comprising:

(a) performing a recombination reaction upon the nucleic acid segment which results in the generation of a product nucleic acid molecule comprising sequencing primer binding sites which flank all or part the nucleic acid segment and allow for sequencing of the nucleic acid segment from either end;

(b) hybridizing the product nucleic acid molecule of (a) with a sequencing primer under conditions which allows for the sequencing primer to hybridize to both of the primer binding sites of the product nucleic acid molecule; and

(c) performing a sequencing reaction,

wherein the sequencing primer is capable of binding to both primer binding sites but mediates 5′

to 3′

extension only when bound to one of the two primer binding sites.

2. The method of claim 1, wherein the recombination reaction of (a) occurs between two nucleic acid molecule which differ in nucleotide sequence.

3. The method of claim 2, wherein both of the nucleic acid molecules are circular.

4. The method of claim 2, wherein each of the two nucleic acid molecules contain two recombination sites, the two recombination sites in each individual nucleic acid molecule do not substantially under go recombination with each other, and each of the two recombination sites in one of the nucleic acid molecules will undergo recombination under suitable conditions with at least one of the recombination sites in the other nucleic acid molecule.

5. The method of claim 2, wherein one or more of the recombination sites are selected from the group consisting of:

(a) attB sites,

(b) attP sites,

(c) attL sites,

(d) attR sites,

(e) lox sites,

(f) psi sites,

(g) dif sites,

(h) cer sites,

(i) frt sites,

and mutants, variants, and derivatives of the recombination sites of (a), (b), (c), (d), (e), (f), (g), (h) or (i) which retain the ability to undergo recombination.

6. The method of claim 5, wherein one of the nucleic acid molecules contains two attB recombination sites and the other nucleic acid molecule contains two attP recombination sites.

7. The method of claim 6, wherein the two sequencing primer binding sites are located in the attP sites.

8. The method of claim 1, wherein the product nucleic acid molecule of (a) comprises the nucleic acid segment which is flanked by attL recombination sites.

9. The method of claim 8, wherein the two sequencing primer binding sites are located in the attL sites.

10. The method of claim 9, wherein the two sequencing primer binding sites encompass the IHF site of the attL sites.

11. The method of claim 9, wherein the two sequencing primer binding sites differ by one, two, three, or four nucleotides.

12. The method of claim 11, wherein, when the two sequencing primer binding sites differ by more than one nucleotide, the nucleotides which are different are located adjacent to each other.

13. The method of claim 9, wherein the sequencing primer is between 12 and 40 nucleotides in length.

14. The method of claim 9, wherein the sequencing primer binding site flanking at least one end of the nucleic acid segment is located within 35-45 nucleotides of the nucleic acid segment to be sequenced.

15. A method for sequencing all or part of a nucleic acid segment comprising:

(a) performing a recombination reaction upon the nucleic acid segment which results in the generation of a product nucleic acid molecule comprising sequencing primer binding sites which flank all or part the nucleic acid segment and allow for sequencing of the nucleic acid segment from either end;

(b) contacting a first subportion of the product nucleic acid molecule of (a) with a first sequencing primer under conditions which allows for the first sequencing primer to hybridize to both of the primer binding sites of the product nucleic acid molecule; and

(c) performing a sequencing reaction,

wherein the first sequencing primer binds to both primer binding sites but mediates 5′

to 3′

extension only when bound to one of the two binding sites.

16. The method of claim 15, further comprising the steps of:

(e) contacting a second subportion of the product nucleic acid molecule of (a) with a second sequencing primer which under conditions which allow for the second sequencing primer to hybridize to the primer binding sites of the product nucleic acid molecule; and

(f) performing a sequencing reaction,

wherein the second sequencing primer binds to both primer binding sites but only mediates 5′

to 3′

extension only when bound to one of the two binding sites and this primer binding site is located at the opposite end of the nucleic acid segment from which the first sequencing primer mediates 5′

to 3′

extension.

17. The method of claim 16, wherein the first sequencing primer and the second sequencing primer are each between 15 and 45 nucleotides in length.

18. The method of claim 16, wherein the first sequencing primer and the second sequencing primer differ in nucleotide sequence by one, two, three, or four nucleotides.

19. The method of claim 18, wherein the first sequencing primer and the second sequencing primer differ in nucleotide sequence at their 3′

termini.

20. The method of claim 19, wherein the first sequencing primer comprises the nucleotide sequence

5′

GTTGCAACAAATTGATGAGCAATTA 3′ and

second sequencing primer comprises the nucleotide sequence

5′

GTTGCAACAAATTGATGAGCAATGC 3′

.

21. A composition comprising an isolated nucleic acid molecule, the nucleic acid molecule comprising:

(a) a first recombination site and a second recombination site,

(b) a nucleic acid segment located between the first and second recombination sites, and

(c) a primer which is capable of binding to two primer binding sites which differ in nucleotide sequence,

wherein one the primer binding sites is located within the first recombination site and the other primer binding site is located within the second recombination site.

22. The composition of claim 21, wherein the nucleic acid molecule is single stranded except for the primer binding sites where the primer is bound.

23. The composition of claim 21, wherein the two different primer binding sites differ from each other by one, two, three, or four nucleotides.

24. The composition of claim 21, wherein the primer is between 10 and 40 nucleotides in length.

25. A reaction mixture comprising the composition of claim 21 and one or more components selected from the group consisting of:

(a) one or more nucleotide triphosphates,

(b) one of more polymerase,

(c) one or more deoxynucleotide triphosphates, and

(d) at least one dideoxynucleotides triphosphate.

26. The composition of claim 21, wherein the nucleic acid molecule is a vector.

27. The composition of claim 26, wherein the vector is a plasmid.

28. An isolated nucleic acid molecule comprising the nucleotide sequence 5′

GAAAATATTG 3′

.

29. The isolated nucleic acid molecule of claim 28 which is a vector.

30. The isolated nucleic acid molecule of claim 29, wherein the vector is a plasmid.

31. A kit comprising an isolated nucleic acid molecule, the nucleic acid molecule comprising:

(a) a first recombination site and a second recombination site,

(b) a nucleic acid segment located between the first and second recombination sites, and

(c) a primer which is capable of binding to two primer binding sites which differ in nucleotide sequence,

wherein one the primer binding sites is located within the first recombination site and the other primer binding site is located within the second recombination site.

32. The kit of claim 31, further comprising one or more component selected from the group consisting of:

(a) one or more nucleotide triphosphates,

(b) one of more polymerase,

(c) one or more deoxynucleotide triphosphates,

(d) at least one dideoxynucleotides triphosphate,

(e) one or more buffers,

(f) one or more additional primers or other nucleic acid molecules, and

(f) one or more sets of instructions.

33. The kit of claim 31, wherein the instruction describe methods for using kit components in sequencing reactions.