Use of interfering RNA in the production of transgenic animals

• US 20050266561A1
• Filed: 11/22/2004
• Published: 12/01/2005
• Est. Priority Date: 11/21/2003
• Status: Active Grant

• Current Assignee: Revivicor, Inc (United Therapeutics Corporation)
• Original Assignee: Revivicor, Inc (United Therapeutics Corporation)
• Inventors: Wells, Kevin
• Granted Patent: US 10,793,873 B2
• Time in Patent Office: Days
• US Class Current: 435/455
• CPC Class Codes: A01K 2217/058 due to expression of inhibitory nucleic acid, e.g. siRNA, antisense
• CPC Class Codes: A01K 2227/108 Swine
• CPC Class Codes: A01K 2267/02 Animal zootechnically ameliorated
• CPC Class Codes: A01K 2267/025 Animal producing cells or organs for transplantation
• CPC Class Codes: A01K 2267/03 Animal model, e.g. for test or diseases
• CPC Class Codes: A01K 67/0275 Genetically modified vertebrates, e.g. transgenic
• CPC Class Codes: A61P 31/14 for RNA viruses
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/1131 against viruses
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 2310/14 interfering N.A.
• CPC Class Codes: C12N 2320/10 in screening processes
• CPC Class Codes: C12N 2320/12 in functional genomics, i.e. for the determination of gene function
• CPC Class Codes: C12N 2510/00 Genetically modified cells
• CPC Class Codes: C12N 2800/60 Vectors containing traps for, e.g. exons, promoters
• CPC Class Codes: C12N 2840/44 being a specific part of the splice mechanism, e.g. donor, acceptor

Abstract

The invention provides cells and animals, as well as methods of producing cells and animals, that express at least one interfering RNA molecule to regulate the expression of a specific gene or family of genes. The invention further provides novel iRNA molecules, as well as DNA templates for producing iRNA molecules.

Claims

2. A method for producing a transgenic cell comprising inserting a DNA construct encoding an iRNA molecule into predetermined location in the genome of the cell wherein the insertion does not disrupt the normal gene expression of the cell.

3. A method to regulate the expression of a target mRNA comprising (i) identifying at least one iRNA sequence that is complementary to the target mRNA;

(ii) identifying a target endogenous gene sequence in a cell;

(iii) manufacturing a DNA construct encoding the iRNA sequence and a targeting sequence that is homologous to the endogenous target gene;

(iv) introducing the DNA construct into the cell; and

(v) growing the cell under conditions in which the iRNa molecule is expressed, thereby regulating expression of the target mRNAs.

4. The method of claim 3, wherein the insertion is into an exon of a target gene.

5. The method of claim 3, wherein the insertion is into an intron of a target gene.

6. The method of claim 3, wherein the insertion does not disrupt the function of the targeted gene.

7. The method of claim 3, wherein the DNA construct contains sequence homologous to the target gene to allow homologous recombination between the target gene and the DNA construct.

8. The method of claim 3, wherein the DNA construct is contained within a synthetic intron.

9. The method of claim 8, wherein the synthetic intron is a functional intron.

10. The method of claim 9, wherein the synthetic intron is inserted into an endogenous intron.

11. The method of claim 8, wherein the synthetic intron is inserted into an endogenous exon.

16-1. A transgenic cell produced according to claim 1 or 2.

17. A transgenic animal comprising the cell of claim or 2.

18. A double stranded iRNA molecule comprising a first nucleotide sequence that is complementary to a first target mRNA and a second nucleotide sequence that is complementary to a second target mRNA, wherein the first and second nucleotide sequences substantially hybridize together to form a double stranded iRNA molecule.

19. The iRNA molecule of claim 18, wherein the first and second target mRNA are the same.

20. The iRNA molecule of claim 18, wherein the first and second target mRNA are different.

21. The iRNA of claim 18, wherein the first and second nucleotide sequences are palindromic.

22. The iRNA molecule of claim 18 further comprising a third nucleotide sequence that separates the first and second nucleotide sequences.

23. The iRNA molecule of claim 18 wherein the first and second nucleotide sequences are between nineteen and thirty-two nucleotides in length.

24. The iRNA molecule of claim 22 wherein the third nucleotide sequence is between 4 and 10 nucleotides in length.

25. A DNA construct that encodes a double stranded iRNA molecule comprising a first nucleotide sequence that is complementary to a first target mRNA and a second nucleotide sequence that is complementary to a second target mRNA, wherein the first and second nucleotide sequences substantially hybridize together to form a double stranded iRNA molecule.

26. A method for producing a double stranded iRNA molecule to regulate the expression of a target mRNA comprising:

(i) identifying at least one nucleotide sequence that is complementary to the target mRNA;

(ii) analyzing the complementary sequence to identify portions of the sequence that can hybridizing together;

(iii) manufacturing an iRNA molecule that contains the two complementary sequences identified in step (ii). wherein the manufacturing can be in a cell.

27. The method of claim 26 wherein the iRNA molecule is encoded by a DNA construct.

28. The method of claim 26 wherein the iRNA molecule further comprising a third nucleotide sequence that separates the two complementary nucleotide sequences that hybridize together.

29. The method of claim 26 wherein the complementary sequence is approximately nineteen to thirty-two nucleotides in length.

30. A single iRNA molecule that regulates the expression of at least two regions of one gene, wherein the expression of the gene is functionally eliminated.

31. A method to eliminate the expression of a target mRNA comprising administering two iRNA molecules that target the same region of the target mRNA.

32. A single iRNA molecule that regulates the expression of a family of genes by targeting a homologous region common to all members of the gene family.

33. An iRNA molecule that inhibits the expression of porcine endogenous retrovirus.

34. The iRNA of claim 33 that binds to multiple types of porcine endogenous retrovirus (PERV).

35. The iRNA of claim 33 wherein the iRNA binds to PERV-A and PERV-B.

36. The iRNA of claim 33 wherein the iRNA binds to PERV-A and PERV-C.

37. The iRNA of claim 33 wherein the iRNA binds to PERV-B and PERV-C.

38. The iRNA molecule of claim 33 that targets the env region of the porcine endogenous retrovirus.

39. The iRNA molecule of claim 38 that targets the gag region of the porcine endogenous retrovirus.

40. The iRNA molecule of claim 39 that targets the pol region of the porcine endogenous retrovirus.

41. The iRNA molecule of claim 39 that targets the following gag sequence:

GTTAGATCCAGGGCTCATAAT, or a sequence with substantial homology or which hybridizes thereto.

42. The iRNA molecule of claim 40 that targets the following pol sequence:

GTTAGATCCAGGGCTCATAAT or a sequence with substantial homology or which hybridizes thereto.