Desmoglein 4 is a novel gene involved in hair growth

• US 20060105977A1
• Filed: 10/14/2005
• Published: 05/18/2006
• Est. Priority Date: 04/17/2003
• Status: Abandoned Application

• Current Assignee: Angela M. Christiano
• Original Assignee: Angela M. Christiano
• Inventors: Christiano, Angela M.
• Application Number:
  US11/251,340
• Publication Number:
  US 20060105977A1
• Time in Patent Office: Days
• US Class Current: 514/44.R
• CPC Class Codes: A61K 47/10 Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61K 9/0014 Skin, i.e. galenical aspects of topical compositions non-active ingredients are additionally classified in A61K47/00; A61K9/0009, A61K9/0021, A61K9/7015, A61K9/7023 take precedence; cosmetic preparations A61K8/00, A61Q; preparations for wound dressings or bandages A61L26/00
• CPC Class Codes: A61K 9/127 Liposomes
• CPC Class Codes: A61P 17/14 for baldness or alopecia
• CPC Class Codes: C07K 14/705 Receptors; Cell surface antigens; Cell surface determinants tumour specific antigens C07K14/4748
• CPC Class Codes: C12N 15/1138 against receptors or cell surface proteins
• CPC Class Codes: C12N 2310/12 catalytic nucleic acids, e.g. ribozymes
• CPC Class Codes: C12N 2310/121 Hammerhead
• CPC Class Codes: C12N 2310/122 Hairpin

Abstract

This invention provides methods and compositions for inhibiting the expression of desmoglein 4. This invention also provides pharmaceutical compositions for inhibiting hair growth in a subject.

Claims

1. A catalytic deoxyribonucleic acid molecule that specifically cleaves a mRNA encoding desmoglein 4 comprising:

(a) a catalytic domain that cleaves mRNA at a defined consensus sequence;

(b) a binding domain contiguous with the 5 ′

end of the catalytic domain; and

(c) a binding domain contiguous with the 3 ′

end of the catalytic domain,

wherein the binding domains are complementary to, and therefore hybridize with, the two regions flanking the defined consensus sequence within the mRNA encoding desmoglein 4 at which cleavage is desired, and wherein each binding domain is at least 4 residues in length and both binding domains have a combined total length of at least 8 residues.

2. The catalytic deoxyribonucleic acid molecule of claim 1, wherein the catalytic domain has the sequence ggctagctacaacga (SEQ ID NO:

5), and cleaves mRNA at the consensus sequence purine;

pyrimidine.

6. The catalytic nucleic acid molecule of claim 1 or 3, wherein the mRNA encoding desmoglein 4 comprises consecutive nucleotides having the sequence set forth in SEQ ID NO:

2 or SEQ ID NO;

4.

7. The catalytic nucleic acid molecule of claim 1 or 3, wherein the desmoglein 4 comprises consecutive amino acids having the sequence set forth in SEQ ID NO:

1.

8. The catalytic nucleic acid molecule of claim 1 or 3, wherein the desmoglein 4 comprises consecutive amino acids having the sequence set forth in SEQ ID NO:

3.

9. The catalytic nucleic acid molecule of claim 1 or 3, wherein the cleavage site within the mRNA encoding desmoglein 4 is located within the first 3000 residues following the mRNA'"'"'s 5′

terminus.

10. The catalytic nucleic acid molecule of claim 9, wherein the cleavage site within the mRNA encoding desmoglein 4 is located within the first 1500 residues following the mRNA'"'"'s 5′

terminus.

11. The catalytic nucleic acid molecule of claim 1 or 3, wherein the mRNA encoding desmoglein 4 is from a subject selected from the group consisting of human, monkey, rat and mouse.

12. A pharmaceutical composition comprising the catalytic nucleic acid molecule of claim 1 or 3 and a pharmaceutically acceptable carrier.

13. The pharmaceutical composition of claim 12, wherein the carrier is an alcohol.

14. The pharmaceutical composition of claim 13, wherein the carrier is ethylene glycol.

15. The pharmaceutical composition of claim 12, wherein the carrier is a liposome.

16. A method of specifically cleaving an mRNA encoding desmoglein 4 comprising contacting the mRNA with the catalytic nucleic acid molecule of claim 1 or 3 under conditions permitting the molecule to cleave the mRNA encoding desmoglein 4.

17. A method of specifically cleaving an mRNA encoding desmoglein 4 in a cell, comprising contacting the cell containing the mRNA with the catalytic nucleic acid molecule of claim 1 or 3 under conditions permitting the catalytic nucleic acid molecule to specifically cleave the mRNA encoding desmoglein 4 in the cell.

18. A method of specifically inhibiting the expression of desmoglein 4 in a cell that would otherwise express desmoglein 4, comprising contacting the cell with the catalytic nucleic acid molecule of claim 1 or 3 so as to specifically inhibit the expression of desmoglein 4 in the cell.

19. A method of specifically inhibiting the expression of desmoglein 4 in a subject'"'"'s cells comprising administering to the subject an amount of the catalytic nucleic acid molecule of claim 1 or 3 effective to specifically inhibit the expression of desmoglein 4 in the subject'"'"'s cells.

20. A method of specifically inhibiting the expression of desmoglein 4 in a subject'"'"'s cells comprising administering to the subject an amount of the pharmaceutical composition of claim 12 effective to specifically inhibit the expression of desmoglein 4 in the subject'"'"'s cells.

21. A method of inhibiting hair production by a hair-producing cell comprising contacting the cell with an effective amount of the catalytic nucleic acid of claim 1 or 3.

22. A method of inhibiting hair growth in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of claim 12.

23. A method of inhibiting the transition of a hair follicle from proliferation to differentiation comprising contacting the follicle with an effective amount of the catalytic nucleic acid of claim 1 or 3.

24. A method of inhibiting the transition of a hair follicle from proliferation to the differentiation comprising contacting the follicle with an effective amount of the pharmaceutical composition of claim 12.

25. The method of claim 17, wherein the cell is a keratinocyte.

26. The method of claim 18, wherein the cell is a keratinocyte.

27. The method of claim 19, wherein the cell is a keratinocyte.

28. The method of claim 20, wherein the cell is a keratinocyte.

29. The method of claim 21, wherein the cell is a keratinocyte.

30. The method of claim 19, wherein the subject is a human.

31. The method of claim 20, wherein the subject is a human.

32. The method of claim 22, wherein the subject is a human.

33. The method of claim 19, wherein the catalytic nucleic acid molecule is administered topically.

34. The method of claim 33, wherein the catalytic nucleic acid is administered dermally.

35. The method of claim 20, wherein the pharmaceutical composition is administered topically.

36. The method of claim 35, wherein the pharmaceutical composition is administered dermally.

37. The method of claim 22, wherein the pharmaceutical composition is administered topically.

38. The method of claim 37, wherein the pharmaceutical composition is administered dermally.

39. A vector which comprises a sequence encoding the catalytic nucleic acid molecule of claim 1 or 3.

40. A host-vector system comprising a cell having the vector of claim 39 therein.

41. A method of producing the catalytic nucleic acid molecule of claim 1 or 3 comprising culturing a cell having therein a vector comprising a sequence encoding said catalytic nucleic acid molecule under conditions permitting the expression of the catalytic nucleic acid molecule by the cell.

3. A catalytic ribonucleic acid molecule that specifically cleaves a mRNA encoding desmoglein 4 comprising:

(a) a catalytic domain that cleaves mRNA at a defined consensus sequence;

(b) a binding domain contiguous with the 5 ′

end of the catalytic domain; and

(c) a binding domain contiguous with the 3 ′

end of the catalytic domain,

wherein the binding domains are complementary to, and therefore hybridize with, the two regions flanking the defined consensus sequence within the mRNA encoding desmoglein 4 at which cleavage is desired, and wherein each binding domain is at least 4 residues in length and both binding domains have a combined total length of at least 8 residues.

4. The catalytic ribonucleic acid molecule of claim 3, wherein the catalytic domain has the sequence ctgatgagtccgtgaggacgaaaca (SEQ ID NO:

6), and cleaves mRNA at the consensus sequence 5′

-NUH-3′

, where N is any nucleotide, U is uridine and H is any nucleotide except guanine.

5. The catalytic ribonucleic acid molecule of claim 3, wherein the molecule is a hammerhead ribozyme or hairpin ribozyme.

42. A nucleic acid molecule that specifically hybridizes under conditions of high stringency to a mRNA encoding a desmoglein 4 so as to inhibit the translation thereof in a cell.

43. The nucleic acid of claim 42, wherein the nucleic acid is a ribonucleic acid.

44. The nucleic acid of claim 42, wherein the nucleic acid is deoxyribonucleic acid.

45. The nucleic acid molecule of claim 42, wherein the nucleic acid molecule is complementary to and hybridizes with a portion of the desmoglein 4-encoding mRNA, and is between 8 and 40 nucleobases in length.

46. The nucleic acid molecule of claim 42, wherein the desmoglein 4 comprises consecutive amino acids having the sequence set forth in SEQ ID NO:

1 or SEQ ID NO;

3.

47. The nucleic acid molecule of claim 42, wherein the mRNA encoding desmoglein 4 comprises consecutive nucleotides having the sequence set forth in SEQ ID NO:

2 or SEQ ID N;

4.

48. A vector which comprises a sequence encoding the nucleic acid molecule of claim 42.

49. A host-vector system comprising a cell having the vector of claim 48 therein.

50. A pharmaceutical composition comprising

(a) the nucleic acid molecule of claim 42 or the vector of claim 48 and

(b) a pharmaceutically acceptable carrier.

51. The pharmaceutical composition of claim 50, wherein the carrier is an alcohol.

52. The pharmaceutical composition of claim 51, wherein the carrier is ethylene glycol.

53. The pharmaceutical composition of claim 50, wherein the carrier is a liposome.

54. A method of specifically inhibiting the expression of desmoglein 4 in a cell that would otherwise express desmoglein 4, comprising contacting the cell with the nucleic acid molecule of claim 42 so as to specifically inhibit the expression of desmoglein 4 in the cell.

55. A method of specifically inhibiting the expression of desmoglein 4 in a subject'"'"'s cells comprising administering to the subject an amount of the nucleic acid molecule of claim 42 effective to specifically inhibit the expression of desmoglein 4 in the subject'"'"'s cells.

56. A method of specifically inhibiting the expression of desmoglein 4 in a subject'"'"'s cells comprising administering to the subject an amount of the pharmaceutical composition of claim 50 effective to specifically inhibit the expression of desmoglein 4 in the subject'"'"'s cells.

57. A method of inhibiting hair production by a hair-producing cell comprising contacting the cell with an effective amount of the nucleic acid molecule of claim 42.

58. A method of inhibiting hair growth in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of claim 50.

59. The method of claim 54, wherein the cell is a keratinocyte.

60. The method of claim 55, wherein the cell is a keratinocyte.

61. The method of claim 56, wherein the cell is a keratinocyte.

62. The method of claim 57, wherein the cell is a keratinocyte.

63. The method of claim 55, wherein the subject is a human.

64. The method of claim 56, wherein the subject is a human.

65. The method of claim 58, wherein the subject is a human.

66. The method of claim 55, wherein the nucleic acid molecule is administered topically.

67. The method of claim 66, wherein the nucleic acid is administered dermally.

68. The method of claim 56, wherein the pharmaceutical composition is administered topically.

69. The method of claim 68, wherein the pharmaceutical composition is administered dermally.

70. A method of producing the nucleic acid molecule of claim 42 comprising culturing a cell having therein a vector comprising a sequence encoding the nucleic acid molecule under conditions permitting the expression of the nucleic acid molecule by the cell.

71. A non-human transgenic mammal, wherein the mammal'"'"'s genome:

(a) has stably integrated therein a nucleotide sequence encoding a human desmoglein 4 operably linked to a promoter, whereby the nucleotide sequence is expressed; and

(b) lacks an expressible endogenous desmoglein 4 encoding nucleic acid sequence.

72. An oligonucleotide comprising consecutive nucleotides that hybridizes with a desmoglein 4-encoding mRNA under conditions of high stringency and is between 8 and 40 nucleotides in length.

73. The oligonucleotide of claim 72, wherein the oligonucleotide inhibits translation of the desmoglein 4-encoding mRNA.

74. The oligonucleotide of claim 72, wherein at least one internucleoside linkage within the oligonucleotide comprises a phosphorothioate linkage.

75. The oligonucleotide of claim 72, wherein the nucleotides comprise at least one deoxyribonucleotide.

76. The oligonucleotide of claim 72, wherein the nucleotides comprise at least one ribonucleotide.

77. The oligonucleotide of claim 72, wherein the desmoglein 4-encoding mRNA encodes human desmoglein 4.

78. The oligonucleotide of claim 77, wherein the desmoglein 4-encoding mRNA comprises consecutive nucleotides, the sequence of which is set forth in SEQ ID NO:

2 or 4.

79. A pharmaceutical composition comprising the oligonucleotide of claim 72 and a pharmaceutically acceptable carrier.

80. A method of treating a subject which comprises administering to the subject an amount of the oligonucleotide of claim 72 effective to inhibit expression of a desmoglein 4 in the subject so as to thereby treat the subject.

81. A method of specifically inhibiting the expression of desmoglein 4 in a cell that would otherwise express desmoglein 4, comprising contacting the cell with the oligonucleotide of claim 72 so as to specifically inhibit the expression of desmoglein 4 in the cell.

82. A method of specifically inhibiting the expression of desmoglein 4 in a subject'"'"'s cells comprising administering to the subject an amount of the oligonucleotide of claim 72 effective to specifically inhibit the expression of desmoglein 4 in the subject'"'"'s cells.

83. A method of specifically inhibiting the expression of desmoglein 4 in a subject'"'"'s cells comprising administering to the subject an amount of the pharmaceutical composition of claim 79 effective to specifically inhibit the expression of desmoglein 4 in the subject'"'"'s cells.

84. A method of inhibiting hair production by a hair-producing cell comprising contacting the cell with an effective amount of the oligonucleotide of claim 72.

85. A method of inhibiting hair growth in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of claim 79.

86. The method of claim 80, 81, 82, 83, 84, or 85, wherein the subject is a mammal.

87. The method of claim 86, wherein the mammal is a human being.