Functional mutant loxP sequences and uses thereof

• US 20070087366A1
• Filed: 10/12/2006
• Published: 04/19/2007
• Est. Priority Date: 10/13/2005
• Status: Active Grant

• Current Assignee: BC Cancer Agency
• Original Assignee: BC Cancer Agency
• Inventors: Holt, Robert, Missirlis, Perseus
• Granted Patent: US 7,696,335 B2
• Time in Patent Office: Days
• US Class Current: 435/6
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 2800/30 Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Abstract

The invention provides methods, kits, and compositions comprising novel mutant loxP sites. Such sites are particularly useful for procedures requiring multiple site-specific recombination reactions, including deletions or insertions of multiple genes or other sequences in the same organism, staged insertions or deletions of genes of the same organism at different times, assembly of large polynucleotide constructs by serial site-specific recombination, and the like. In one aspect, compositions of the invention includes particular mutant spacer oligonucleotides of loxP recombination elements, the recombination elements themselves, and pairs of non-promiscuous mutant loxP sites.

Claims

1. A composition comprising a loxP recombination element, the loxP recombination element having a left inverted repeat region, a right inverted repeat region, and a spacer region selected from the group of spacer regions listed in Table II.

2. The compositions of claim 1 wherein said loxP recombination element is defined by the formula:

LE₁-S₁-RE₁

where;

LE₁ is a mutant or wild type left inverted repeat region of a loxP recombination element and RE₁ is a mutant or wild type right inverted repeat region of a loxP recombination element such that whenever LE₁ is a wild type sequence, RE₁ is a mutant sequence, and whenever LE₁ is a mutant sequence, RE₁ is a wild type sequence.

3. The composition of claim 2 wherein LE₁ is lox71 left inverted repeat region and RE₁ is a wild type right inverted repeat of a loxP recombination element.

7. The composition of claim 2 wherein RE₁ is lox66 right inverted repeat region and LE₁ is a wild type left inverted repeat region of a loxP recombination element.

4. The composition of 3 wherein said spacer region is selected from the group consisting of:

5. The composition of 3 wherein said spacer region is selected from the group consisting of:

6. The composition of 3 wherein said spacer region is selected from the group consisting of:

8. The composition of 7 wherein said spacer region is selected from the group consisting of:

9. The composition of 7 wherein said spacer region is selected from the group consisting of:

10. The composition of 7 wherein said spacer region is selected from the group consisting of:

11. A composition comprising a pair of mutant loxP recombination elements, the pair being defined as follows:

a first member of a pair is defined as;

LE₁-S₁-RE₁

and a second member of the pair is defined as;

LE₂-S₂-RE₂

where;

LE₁ is a mutant or wild type left inverted repeat of a loxP recombination element and RE₁ is a mutant or wild type right inverted repeat of a loxP recombination element such that whenever LE₁ is a wild type sequence, RE₁ is a mutant sequence, and whenever LE₁ is a mutant sequence, RE₁ is a wild type sequence;

LE₂ is a mutant or wild type left inverted repeat of a loxP recombination element and RE₂ is a mutant or wild type right inverted repeat of a loxP recombination element such that whenever LE₂ is a wild type sequence, RE₂ is a mutant sequence, and whenever LE₂ is a mutant sequence, RE₂ is a wild type sequence;

with the proviso that whenever LE₁ is a mutant sequence, then LE₂ is a wild type sequence; and

S₁ and S₂ are members of a pair of mutant loxP spacer regions selected from the group of pairs of loxP spacer regions listed in Table III.

12. The composition of claim 11 wherein LE₁ is lox71 left inverted repeat region and RE₁ is a wild type right inverted repeat of a loxP recombination element and wherein RE₂ is lox66 right inverted repeat region and LE₂ is a wild type left inverted repeat region of a loxP recombination element.

13. The composition of claim 11 wherein S₁ and S₂ are each a mutant loxP spacer region each having the same sequence selected from the group consisting of:

14. The composition of claim 13 wherein S₁ and S₂ are each mutant loxP spacer regions such that whenever S₁ is selected from column 1 below S₂ is the sequence in the column 2 of the same row as S₁, and whenever S₁ is selected from column 2 S₂ is the sequence in column 1 of the same row as S₁:

15. The composition of claim 14 wherein LE₁ is lox71 left inverted repeat region and RE₁ is a wild type right inverted repeat of a loxP recombination element and wherein RE₂ is lox66 right inverted repeat region and LE₂ is a wild type left inverted repeat region of a loxP recombination element.

16. The composition of claim 11 wherein S₁ and S₂ are each a mutant loxP spacer region each having the same sequence selected from the group consisting of:

17. The composition of claim 16 wherein LE₁ is lox71 left inverted repeat region and RE₁ is a wild type right inverted repeat of a loxP recombination element and wherein RE₂ is lox66 right inverted repeat region and LE₂ is a wild type left inverted repeat region of a loxP recombination element.

18. A composition comprising a pair of mutant loxP recombination elements, the pair being defined as follows:

a first member of a pair is defined as;

LE₁-S₁-RE₁

and a second member of the pair is defined as;

LE₂-S₂-RE₂

where;

LE₁ is a mutant or wild type left inverted repeat of a loxP recombination element and RE₁ is a mutant or wild type right inverted repeat of a loxP recombination element such that whenever LE₁ is a wild type sequence, RE₁ is a mutant sequence, and whenever LE₁ is a mutant sequence, RE₁ is a wild type sequence;

LE₂ is a mutant or wild type left inverted repeat of a loxP recombination element and RE₂ is a mutant or wild type right inverted repeat of a loxP recombination element such that whenever LE₂ is a wild type sequence, RE₂ is a mutant sequence, and whenever LE₂ is a mutant sequence, RE₂ is a wild type sequence;

with the proviso that whenever LE₁ is a mutant sequence, then LE₂ is a wild type sequence; and

S₁ and S₂ are members of a pair of non-self recombining mutant loxP spacer regions selected from the pairs of spacer regions listed in Table IV.

19. The composition of claim 18 wherein LE₁ is lox71 left inverted repeat region and RE₁ is a wild type right inverted repeat of a loxP recombination element and wherein RE₂ is lox66 right inverted repeat region and LE₂ is a wild type left inverted repeat region of a loxP recombination element.

20. A kit for carrying out multiple non-cross reacting recombination reactions, the kit comprising at least one pair of mutant loxP recombination elements selected from the group of pairs defined by the formula:

a first member of a pair is defined as;

LE₁-S₁-RE₁

and a second member of the pair is defined as;

LE₂-S₂-RE₂

where;

LE₁ is a mutant or wild type left inverted repeat of a loxP recombination element and RE₁ is a mutant or wild type right inverted repeat of a loxP recombination element such that whenever LE₁ is a wild type sequence, RE₁ is a mutant sequence, and whenever LE₁ is a mutant sequence, RE₁ is a wild type sequence;

LE₂ is a mutant or wild type left inverted repeat of a loxP recombination element and RE₂ is a mutant or wild type right inverted repeat of a loxP recombination element such that whenever LE₂ is a wild type sequence, RE₂ is a mutant sequence, and whenever LE₂ is a mutant sequence, RE₂ is a wild type sequence;

with the proviso that whenever LE₁ is a mutant sequence, then LE₂ is a wild type sequence; and

S₁ and S₂ are each a mutant loxP spacer region each having the same sequence selected from the group consisting of;

GTATAGTAGCGTATGTGGTTACGG GGCTATAGTTGTATGGTTTTAGGT TCGTAGGCGGATAGTAGAGTACGC GTGTATTTAGGTATGC

or, S₁ is GTGTACGC whenever S₂ is GTGTACGG; and

S₂ is GTGTACGC whenever S₁ is GTGTACGG.

21. The kit of claim 20 wherein LE₁ is lox71 left inverted repeat region and RE₁ is a wild type right inverted repeat of a loxP recombination element and wherein RE₂ is lox66 right inverted repeat region and LE₂ is a wild type left inverted repeat region of a loxP recombination element.