PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD
First Claim
Patent Images
1. A probe for detecting a DNA of Candida glabrata which is a pathogenic fungus, comprising one of the following base sequences (1) to (5):
- (1) ggtgttttatcacacgactcgacact (SEQ ID NO.
1) or a complementary sequence thereof;
(2) ggagttctcccagtggatgcaaac (SEQ ID NO.
2) or a complementary sequence thereof;
(3) ggccatatcagtatgtgggacacg (SEQ ID NO.
3) or a complementary sequence thereof;
(4) aggttttaccaactcggtgttgatctag (SEQ ID NO.
4) or a complementary sequence thereof; and
(5) a mutated sequence which is obtained by deletion, substitution, or addition of a base on one of the sequences of SEQ ID NOS. 1 to 4 and the complementary sequences thereof within a range that the mutated sequence retains a function as the probe.
1 Assignment
0 Petitions
Accused Products
Abstract
A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.
124 Citations
7 Claims
-
1. A probe for detecting a DNA of Candida glabrata which is a pathogenic fungus, comprising one of the following base sequences (1) to (5):
-
(1) ggtgttttatcacacgactcgacact (SEQ ID NO.
1) or a complementary sequence thereof;(2) ggagttctcccagtggatgcaaac (SEQ ID NO.
2) or a complementary sequence thereof;(3) ggccatatcagtatgtgggacacg (SEQ ID NO.
3) or a complementary sequence thereof;(4) aggttttaccaactcggtgttgatctag (SEQ ID NO.
4) or a complementary sequence thereof; and(5) a mutated sequence which is obtained by deletion, substitution, or addition of a base on one of the sequences of SEQ ID NOS. 1 to 4 and the complementary sequences thereof within a range that the mutated sequence retains a function as the probe. - View Dependent Claims (5)
-
-
2. A probe set for detecting a DNA of Candida glabrata which is a pathogenic fungus, comprising at least two of the following probes (A) to (P):
-
(A) a probe including a base sequence represented by ggtgttttatcacacgactcgacact (SEQ ID NO.
1);(B) a probe including a base sequence represented by ggagttctcccagtggatgcaaac (SEQ ID NO.
2);(C) a probe including a base sequence represented by ggccatatcagtatgtgggacacg (SEQ ID NO.
3);(D) a probe including a base sequence represented by aggttttaccaactcggtgttgatctag (SEQ ID NO.
4);(E) a probe including a complementary sequence of SEQ ID NO. 1; (F) a probe including a complementary sequence of SEQ ID NO. 2; (G) a probe including a complementary sequence of SEQ ID NO. 3; (H) a probe including a complementary sequence of SEQ ID NO. 4; (I) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 1 within a range that the mutated sequence retains a function as the probe; (J) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 2 within a range that the mutated sequence retains the function as the probe; (K) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 3 within a range that the mutated sequence retains the function as the probe; (L) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 4 within a range that the mutated sequence retains the function as the probe; (M) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 1 within a range that the mutated sequence retains the function as the probe; (N) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 2 within a range that the mutated sequence retains the function as the probe; (O) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 3 within a range that the mutated sequence retains the function as the probe; and (P) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 4 within a range that the mutated sequence retains the function as the probe. - View Dependent Claims (3, 4, 6, 7)
-
Specification