METHODS OF GENETIC ANALYSIS INVOLVING THE AMPLIFICATION OF COMPLEMENTARY DUPLICONS

• US 20090150080A1
• Filed: 02/16/2006
• Published: 06/11/2009
• Est. Priority Date: 02/16/2005
• Status: Active Grant

• Current Assignee: Cy O'Connor Erade Village Foundation
• Original Assignee: Genetic Technologies Limited
• Inventors: Williamson, Joseph Frederick, Dawkins, Roger L., Millman, John Anthony
• Granted Patent: US 8,315,816 B2
• Time in Patent Office: Days
• US Class Current: 702/19
• CPC Class Codes: C12Q 1/6876 Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
• CPC Class Codes: G16B 10/00 ICT specially adapted for evolutionary bioinformatics, e.g. phylogenetic tree construction or analysis
• CPC Class Codes: G16B 30/00 ICT specially adapted for sequence analysis involving nucleotides or amino acids
• CPC Class Codes: G16B 30/10 Sequence alignment; Homology search

Abstract

The invention relates to methods for genetic analysis of DNA sequences containing complementary duplicons which are duplicated and linked DNA sequences separated by an intermediate sequence. Furthermore, the invention relates to the Bidirectional Amplification of Complementary Duplicons (BACD) using a single primer. The amplification of complementary duplicons can be used for a variety of purposes such as, but not limited to, determining the species from which a sample comprising genomic DNA is derived, or used as a marker for a trait of interest. Also provided are means for analysing large datasets which can be used to identify primers useful for the genetic analysis methods of the invention.

Claims

1. A method of genetic analysis comprising:

amplifying a complementary duplicon(s) in genomic DNA in a sample from an individual; and

generating a profile of the amplification products,

wherein the profile is characteristic of the genome.

23. The method of claim 1, further comprising identifying a primer, or set of primer(s), comprising:

performing a method according to claim 21;

using the information obtained about the duplication to design a primer, or set of primer(s), for amplification; and

testing the primer, or set of primers, in an amplification reaction on DNA, or in silico on genomic sequences, to determine if the primer, or set of primer(s), produce a profile characteristic of the genome.

2-5. -5. (canceled)

6. A method of genetic analysis comprising:

i) obtaining a first nucleic acid sequence profile derived from amplification of a complementary duplicon(s) in genomic DNA in a sample from an individual,

ii) comparing the first nucleic acid sequence profile with one or more reference nucleic acid sequence profiles obtained by the amplification of the complementary duplicon(s) from one of more known species, and

iii) determining the species from which the sample is derived based on the similarity of the first nucleic acid sequence profile when compared to the reference nucleic acid sequence profiles.

7. (canceled)

8. A method for detecting the presence of, and/or quantifying the extent of, contaminating DNA in a sample comprising:

i) obtaining a first nucleic acid sequence profile derived from amplification of a complementary duplicon(s) in genomic DNA in a sample,

ii) comparing the first nucleic acid sequence profile with one or more reference nucleic acid sequence profiles obtained by the amplification of the complementary duplicon(s) from one of more known species,

iii) determining if the sample is derived from a single species based on similarity of the first nucleic acid sequence profile when compared to the reference nucleic acid sequence profiles,

iv) if the sample comprises DNA from at least two different species, determining the two or more species from which the sample is derived based on the similarity of the first nucleic acid sequence profile when compared to the reference nucleic acid sequence profiles, and

v) optionally, quantifying the relative concentration of the DNA from the two or more different species in the sample.

9. A method of estimating the divergence times between two different species, breeds, cultivars or strains comprising:

i) obtaining a nucleic acid sequence profile derived from amplification of a complementary duplicon(s) in genomic DNA in a sample from an individual of each species, breed, cultivar or strain; and

ii) comparing the range of sizes of the products of amplification to determine the evolutionary relationship of the two species, breeds, cultivars or strains.

10-20. -20. (canceled)

21. A method of comparing sequences in genomic DNA comprising:

representing each base in each sequence in binary form so that each sequence is a string of bits;

dividing a portion of each sequence by a binary number at a designated location in each sequence to obtain a binary remainder;

storing each remainder at the designated location of the respective sequence; and

comparing the remainders to determine duplication between the sequences.

22. A computer program to control a computer to compare sequences in genomic DNA, the computer program being operable to control the computer comprising:

represent each base in each sequence in binary form so that each sequence is a string of bits;

divide a portion of each sequence by a binary number at a designated location in each sequence to obtain a binary remainder;

store each remainder at the designated location of the respective sequence; and

compare the remainders to determine duplication between the sequences.

24. A composition comprising, an oligonucleotide primer for use in amplifying a complementary duplicon comprising, a primer that can be used to generate a profile of the amplification products characteristic of a genome of an animal.

25. The oligonucleotide primer of claim 24, wherein the primer is selected from the group consisting of:

a) an oligonucleotide comprising a sequence selected from the group consisting of;

ATGAGCTTGTCTACACCT (SEQ ID NO;

     1), GGCACAATCGGTCCTACCAGAGCTA (SEQ ID NO;

     2), GAGATCGAGACCATCCTGGCTAACAA (SEQ ID NO;

     3), and CCGTGTTAGCCAGGATGGTCTCGAT (SEQ ID NO;

     8),

b) an oligonucleotide comprising a sequence which is the reverse complement of any oligonucleotide provided in a), and

c) a variant of a) or b) which hybridizes under amplification conditions to the same complementary duplicon as a) or b).

26. The composition of claim 24 further comprising an acceptable carrier.

27. A kit for amplifying a complementary duplicon comprising at least one primer which hybridizes to a complementary duplicon.

28. (canceled)

29. A method of identifying one or more subsets of elements in at least one set of elements, such that the one or more subsets match a subset of interest (SOI) to a predefined level of congruency comprising:

forming an N-dimensional matrix of elements, wherein a transform of a subset of the one or more subsets is represented by a dimension of the matrix;

storing an identifier at each position in the matrix, each identifier representing a subset transform; and

finding at least one pair of matching identifiers in the matrix.

30. The method of claim 29, further comprising concatenating matched pairs of identifiers to provide a match between transforms of the one or more subsets and the SOI to the predefined level of congruency.

47. The method of claim 29, further comprising using a computer program for identifying one or more subsets of elements in at least one set of elements, such that the one or more subsets match a subset of interest (SOI) to a predefined level of congruency, the computer program capable of instructing a processor to perform the method steps or features of claim 29.

31-37. -37. (canceled)

38. An N-dimensional matrix of elements for use in identifying one or more subsets of elements in at least one set of elements, such that the one or more subsets match a subset of interest (SOI) to a predefined level of congruency comprising:

an identifier at each position in the matrix, each identifier representing a subset transform;

wherein a transform of a subset of the one or more subsets is represented by a dimension of the matrix and at least one pair of matching identifiers in the matrix are found.

39. The N-dimensional matrix of claim 38, wherein matched pairs of identifiers are concatenated to provide a match between transforms of the one or more subsets and the SOI to the predefined level of congruency.

40-46. -46. (canceled)

48. A method of identifying one or more subsets each having elements that substantially match elements in a subset of interest (SOI), each of the subsets forming part of a set of elements or sets of elements comprising:

forming a matrix including a list or partial list of each element in the set or sets, the position in the set or sets of each element and at least one offset indicating the position of another of the same element in the set or sets;

selecting the position of an element in the SOI;

identifying one or more of the offsets for the selected element and for adjacent elements to the selected element in the selected SOI,

finding matching elements in the set or sets of elements to the elements in the selected SOI based on the offsets.

56. The method of claim 48, further comprising using a computer program for identifying one or more subsets each having elements that substantially match elements in a subset of interest (SOI), each of the subsets forming part of a set of elements or sets of elements, the computer program capable of instructing a processor to perform the method steps or have the features of claim 48.

49-51. -51. (canceled)

52. A matrix for use in identifying one or more subsets each having elements that substantially match elements in a subset of interest (SOI), each of the subsets forming part of a set of elements or sets of elements comprising:

a list or partial list of each element in the set or sets;

the position in the set or sets of each element; and

at least one offset indicating the position of another of the same element in the set or set;

wherein the position of an element in the SOI is selected, one or more offsets for the selected element and for adjacent elements to the selected element in the selected SOI are identified and thereafter the matrix is used to find matching elements in the set or sets of elements to the elements in the selected SOI based on the offsets.

53-55. -55. (canceled)

57. A method of identifying one or more subsets of elements such that at least one element in the one or more subsets of elements is located in a selected subset of interest (SOI), each of the one or more subsets of elements and the selected SOI forming part of at least one set of elements comprising:

determining an identifier for the SOI;

determining an identifier for each of the one or more subsets of elements; and

comparing each identifier of the one or more subsets to the SOI identifier in order to find elements in any of the one or more subsets that are also in the SOI which occurs when the compared identifiers are identical.

67. A computer program for identifying one or more subsets of elements, at least one element in the one or more subsets of elements is located in a selected subset of interest (SOI), each of the one or more subsets of elements and the selected SOI forming part of at least one set of elements, the computer program instructing a processor to undertake any one or more of the method steps of features of claim 57.

58-66. -66. (canceled)