Aptamers that bind thrombin with high affinity

• US 20090221680A1
• Filed: 08/23/2006
• Published: 09/03/2009
• Est. Priority Date: 08/26/2005
• Status: Active Grant

• Current Assignee: Archemix Corp. (Baxter International Inc.)
• Original Assignee: Archemix Corp. (Baxter International Inc.)
• Inventors: Fontana, David, Wagner-Whyte, Jess, Diener, John L.
• Granted Patent: US 7,998,939 B2
• Time in Patent Office: Days
• US Class Current: 514/44.R
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: A61P 1/16 for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• CPC Class Codes: A61P 13/12 of the kidneys
• CPC Class Codes: A61P 7/02 Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
• CPC Class Codes: A61P 7/08 Plasma substitutes; Perfusion solutions; Dialytics or haemodialytics; Drugs for electrolytic or acid-base disorders, e.g. hypovolemic shock artificial tears A61P27/04
• CPC Class Codes: A61P 9/00 Drugs for disorders of the cardiovascular system
• CPC Class Codes: C12N 15/115 Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
• CPC Class Codes: C12N 2310/16 Aptamers

Abstract

The invention provides aptamers capable of binding to thrombin useful as therapeutics for and diagnostics of coagulation related disorders and/or other diseases or disorders in which thrombin has been implicated. The invention further provides materials and methods for the administration of aptamers capable of binding to thrombin.

Claims

1. An aptamer that binds to a thrombin target, wherein the aptamer decreases or inhibits thrombin mediated coagulation and the aptamer is ARC2172 (SEQ ID NO 294) or an aptamer that has substantially the same ability as ARC2172 (SEQ ID NO 294) to decrease or inhibit thrombin mediated coagulation, wherein the aptamer binds to human thrombin with a K_D of less than 1 nM and wherein the aptamer is 55 nucleotides or less in length.

2. The aptamer of claim 1, wherein the aptamer does not comprise a 5-bromodeoxyuridine modification at the majority of its thymidine or uridine residues.

3. The aptamer of claim 1, wherein the aptamer'"'"'s ability to decrease or inhibit thrombin mediated coagulation is assessed by measuring the aptamer'"'"'s ability to decrease or inhibit activated clotting time or prothrombin time.

4. The aptamer of claim 3, wherein the aptamer decreases or inhibits thrombin mediated coagulation in vivo.

5. The aptamer of claim 4, wherein the aptamer decreases or inhibits thrombin mediated coagulation in a human subject.

18. An aptamer according to claim 1, wherein the aptamer is single stranded deoxyribonucleic acid.

19. An aptamer according to claim 1, wherein the aptamer comprises at least one chemical modification.

20. The aptamer of claim 19, wherein the modification is selected from the group consisting of:

a chemical substitution at a sugar position;

a chemical substitution at a phosphate position, and a chemical substitution at a base position, of the nucleic acid.

21. The aptamer of claim 19, wherein the modification is selected from the group consisting of:

incorporation of a modified nucleotide, 3′

capping, conjugation to a high molecular weight, non-immunogenic compound, and conjugation to a lipophilic compound.

22. The aptamer of claim 19, wherein the modification is conjugation to a non-immunogenic, high molecular weight compound and wherein the compound is polyalkylene glycol.

23. The aptamer of claim 22 wherein the polyalkylene glycol is polyethylene glycol.

24. An aptamer of claim 1, wherein the aptamer decreases or inhibits thrombin mediated coagulation in vitro.

25. A method comprising administering an aptamer according to claim 1 to a subject or an extracorporeal circuit in an amount effective to decrease or inhibit thrombin mediated coagulation in the subject.

26. The method of claim 25, wherein the subject is human.

27. A composition comprising an aptamer of claim 1 or a salt thereof in an amount effective to decrease or inhibit thrombin mediated coagulation in a subject and a pharmaceutically acceptable carrier or diluent.

28. A method comprising administering the composition of claim 27 to a subject in need thereof.

29. The method of claim 28, wherein the subject is human.

30. A method according to claim 25, wherein the human subject is renally impaired and wherein the aptamer for use in the method is not conjugated to a PEG.

31. A method according to claim 25, wherein the human subject has heparin induced thrombocytopenia.

32. A method according to claim 25, wherein the human subject is heparin resistant.

33. A method according to claim 25, wherein the subject has impaired hepatic function.

34. A method according to claim 25, wherein the aptamer is administered to the subject before, during, after or any combination thereof, a surgical procedure on the subject.

35. The method of claim 34, wherein the surgical procedure is selected from the group consisting of cardiopulmonary by-pass surgery, coronary artery bypass graft surgery, percutaneous coronary intervention, angioplasty, cardiovascular and peripheral vascular open and endovascular surgery, stent placement surgery, heart valve replacement surgery, surgery to treat coronary disease and/or vascular disease in veins or arteries, and surgery to treat peripheral arterial occlusive disease.

36. The method of claim 25, wherein the aptamer is ARC2172 (SEQ ID NO 294).

37. The method of claim 35, wherein the aptamer is ARC2172 (SEQ ID NO 294) and the surgical procedure is coronary artery bypass graft surgery.

38. The method of claim 35, wherein the aptamer is ARC2172 (SEQ ID NO 294) and the surgical procedure is percutaneous coronary intervention.

39. The method of claim 35, wherein the surgical procedure is cardiopulmonary by-pass surgery and an open, and non-heparin bonded circuit is used during the surgery.

6. An aptamer that binds to thrombin selected from the group consisting of:

SEQ ID NOs 9-41, 43-191, 193-204, 208-304, 307-329, 331-332, 334, 336-337, 340-392, 396-397, 400, and 402-440.

7. An aptamer that binds to thrombin comprising the following nucleic acid sequence:

CCTAGGTTGGGTAGGGTGGTGG (SEQ ID NO;

441).

8. The aptamer of claim 7, wherein the aptamer comprises a nucleic acid sequence selected from the group consisting of:

14. An aptamer according to claim 7, wherein the aptamer binds to thrombin with a K_D of less than 1 nM.

15. An aptamer according to claim 7, wherein the aptamer has at least substantially the same ability as ARC2172 (SEQ ID NO 294) to decrease or inhibit thrombin mediated coagulation.

16. An aptamer according to claim 7, wherein the thrombin target is human thrombin.

9. An aptamer comprising the following nucleic acid sequence N₁N₂N₃TAGGTTGGGTAGGGTGGTN′

₃N′

₂N′

₁ (SEQ ID NO;

442) wherein N₁, N₂, or N₃ is any nucleotide that forms a base pair with N′

₁, N′

₂ or N′

₃ respectively, wherein N₁, N₂, and N₃, may each be the same nucleotide or different nucleotides and the aptamer decreases or inhibits thrombin mediated coagulation.

10. The aptamer of claim 9, wherein N₁, N₂, or N₃ are deoxy nucleotides.

11. The aptamer of claim 9, wherein at least two of N₁, N₂, or N₃ comprise a 2′

OMe modification.

12. The aptamer of claim 9, further comprising the sequence N₁N₂N₃N₄N₅N₆TAGGTTGGGTAGGGTGGTN′

₆N′

₅N′

₄ N′

₃N′

₂N′

₁ (SEQ ID NO;

445) wherein N₁, N₂, N₃, N₄, N₅, or N₆ is any nucleotide that forms a base pair with N′

₁, N′

₂, N′

₃, N′

₄, N′

₅, or N′

₆ respectively, wherein N₁, N₂, N₃, N₄, N₅, or N₆ may each be the same nucleotide or different nucleotides and the aptamer decreases or inhibits thrombin mediated coagulation.

13. The aptamer of claim 9, wherein N is a guanosine or cytidine nucleotide residue.

17. (canceled)