IMMUNOSTIMULATORY OLIGONUCLEOTIDES AND USE THEREOF IN PHARMACEUTICALS

• US 20090263413A1
• Filed: 05/31/2007
• Published: 10/22/2009
• Est. Priority Date: 05/31/2006
• Status: Active Grant

• Current Assignee: Osaka University, Toray Industries Incorporated
• Original Assignee: Osaka University, Toray Industries Incorporated
• Inventors: Soneda, Akiko, Narumi, Hideki, Akira, Shizuo, Masumoto, Hajime, Kaneda, Akihito, Iwamura, Tomokatsu
• Granted Patent: US 8,592,566 B2
• Time in Patent Office: Days
• US Class Current: 424/189.100
• CPC Class Codes: A61K 2039/55561 CpG containing adjuvants; Oligonucleotide containing adjuvants
• CPC Class Codes: A61K 31/711 Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
• CPC Class Codes: A61P 1/16 for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 31/14 for RNA viruses
• CPC Class Codes: A61P 37/04 Immunostimulants
• CPC Class Codes: A61P 37/06 Immunosuppressants, e.g. drugs for graft rejection
• CPC Class Codes: A61P 37/08 Antiallergic agents antiasthmatic agents A61P11/06; ophthalmic antiallergics A61P27/14

Abstract

A novel immunostimulatory oligonucleotide by which an IFN-inducing activity is enhanced and an inflammatory cytokine-inducing activity is reduced, and a pharmaceutical containing the same, and an application thereof are provided. That is, the present invention provides the immunostimulatory oligonucleotide composed of a base sequence represented by a formula: 5′-(G)_MPXCGYQ(G)_N-3′ (X and Y are mutually independent and represent an arbitrary sequence which has a length of 0 to 10 nucleotides and does not contain 4 or more consecutive G residues, and a length of X+Y is 6 to 20 nucleotides; XCGY contains a palindrome sequence having a length of at least 8 nucleotides and has a length of 8 to 22 nucleotides; P and Q are mutually independent and represent one nucleotide other than G; M represents an integer of 6 to 10 and N represents an integer of 0 to 3) wherein a full length thereof is 16 to 37 nucleotides (except for an oligonucleotide composed of a basesequence represented by SEQ ID NO:5), the pharmaceutical application thereof.

Claims

1. An immunostimulatory oligonucleotide comprising:

the base sequence thereof consisting of the sequence represented by the formula;

5′

-(G)_MPXCGYQ(G)_N-3′

(C is cytosine, G is guanine;

X and Y are mutually independent and represent each an arbitrary sequence which has a length of 0 to 10 nucleotides and does not contain 4 or more consecutive guanine residues, and a length of x+Y is 6 to 20 nucleotides;

XCGY contains a palindrome sequence having a length of at least 8 nucleotides and has a length of 8 to 22 nucleotides;

P and Q are mutually independent and represent one nucleotide other than guanine, and M represents an integer of 6 to 10 and N represents an integer of 0 to 3; and

each nucleotide length of X and Y needs not be necessarily the same length.) and

16 to 37 nucleotides in total,

except an oligonucleotide of which the base sequence is represented as SEQ ID NO;

5 [GGGGGGTGCCGATCGGCAGGG]).

2. The immunostimulatory oligonucleotide according to claim 1 wherein the M represents the integer of 6 to 8 and the total length is 16 to 35 nucleotides.

3. The immunostimulatory oligonucleotide according to claim 1, wherein the XCGY has a length of 9 or 10 nucleotides and the total length is 17 to 23 nucleotides.

4. The immunostimulatory oligonucleotide according to claim 1, wherein the XCGY contains any one base sequence selected from CGATCG (SEQ ID NO:

59), ATCGAT (SEQ ID NO;

60) and GACGTC (SEQ ID NO;

61).

5. The immunostimulatory oligonucleotide according to claim 1, wherein the XCGY contains CGATCG (SEQ ID NO:

59).

6. The immunostimulatory oligonucleotide according to claim 4, wherein the base sequence of the immunostimulatory oligonucleotide containing CGATCG (SEQ ID NO:

59) consisting of a base sequence selected from the group consisting of SEQ ID NOs;

6, 7, 9 to 11, 5 to 18, 22, 24, 26, 28, 48, 50 to 52, 54, 95 and 97.

7. The immunostimulatory oligonucleotide according to claim 4, wherein the base sequence of the immunostimulatory oligonucleotide containing ATCGAT (SEQ ID NO:

60) consisting of the base sequence of SEQ ID NO;

30.

8. The immunostimulatory oligonucleotide according to claim 4, wherein the base sequence of the immunostimulatory oligonucleotide containing GACGTC (SEQ ID NO:

61) consisting of a base sequence selected from the group consisting of the base sequences of SEQ ID NOs;

40 and 42.

10. The immunostimulatory oligonucleotide according to claim 1, wherein a phosphodiester linkage at all or a part of internucleotides is modified with phosphorothioate.

11. The immunostimulatory oligonucleotide according to claim 10, wherein the phosphodiester linkage of at least a part of internucleotides, in a consecutive G sequence at the 5′

terminus is modified with phosphorothioate.

12. The immunostimulatory oligonucleotide according to claim 10, wherein the phosphodiester linkage of at least a part of internucleotides, at the 3′

terminus is modified with phosphorothioate.

13. A pharmaceutical containing the immunostimulatory oligonucleotide according to claim 1 as an active ingredient.

14. A therapeutic or preventive agent for an allergic disease containing the immunostimulatory oligonucleotide according to claim 1 as an active ingredient.

15. The therapeutic or preventive agent for the allergic disease according to claim 14, wherein said allergic disease is a pollen allergic disease.

16. A vaccine containing the immunostimulatory oligonucleotide according to claim 1 as an adjuvant.

17. A therapeutic or preventive agent for hepatitis containing the immunostimulatory oligonucleotide according to claim 1 as an active ingredient.

18. The therapeutic or preventive agent for hepatitis according to claim 17, wherein the hepatitis is viral hepatitis.

19. The therapeutic or preventive agent for hepatitis according to claim 18, wherein the viral hepatitis is hepatitis B or hepatitis C.

23. A method for treating or preventing an allergic disease by the immunostimulatory oligonucleotide according to claim 1.

24. A method of using the immunostimulatory oligonucleotide according to claim 1 as an adjuvant for a vaccine.

25. A method of treating or preventing hepatitis by the immunostimulatory oligonucleotide according to claim 1.

9. (canceled)

20-22. -22. (canceled)