PROBE, PROBE SET, PROBE-IMMOBILIZED CARRIER, AND GENETIC TESTING METHOD
First Claim
1. A probe for detecting a gene of infectious disease pathogenic bacterium, Porphyromonas gingivalis, capable of hybridizing with the 16S rRNA coding region of Porphyromonas gingivalis, said probe showing a hybridization intensity weak enough to avoid cross-hybridization with the 16S rRNA coding region of Porphyromonas asaccharolytica, said probe having any one of the following base sequences (1) to (4):
- (1) TTATAGCTGTAAGATAGGCATGCGTCCC (SEQ ID NO.
59) or a complementary sequence thereof;
(2) AACGGGCGATACGAGTATTGCATTGA (SEQ ID NO.
60) or a complementary sequence thereof;
(3) ATATACCGTCAAGCTTCCACAGCGA (SEQ ID NO.
61) or a complementary sequence thereof; and
(4) a modified sequence prepared such that any one of the sequences of SEQ ID NOS. 59 to 61 and the complementary sequences thereof is subjected to base deletion, substitution, or addition as far as the modified sequence retains a function as the probe.
1 Assignment
0 Petitions
Accused Products
Abstract
A nucleic acid probe for classification of pathogenic bacterial species is capable of collectively detecting bacterial strains of the same species and differentially detecting them from other bacterial species. Any one of the base sequences of SEQ ID NOS. 59 to 61 or a combination of at least two of them is used for detecting the gene of an infectious disease pathogenic bacterium.
-
Citations
13 Claims
-
1. A probe for detecting a gene of infectious disease pathogenic bacterium, Porphyromonas gingivalis, capable of hybridizing with the 16S rRNA coding region of Porphyromonas gingivalis, said probe showing a hybridization intensity weak enough to avoid cross-hybridization with the 16S rRNA coding region of Porphyromonas asaccharolytica, said probe having any one of the following base sequences (1) to (4):
-
(1) TTATAGCTGTAAGATAGGCATGCGTCCC (SEQ ID NO.
59) or a complementary sequence thereof;(2) AACGGGCGATACGAGTATTGCATTGA (SEQ ID NO.
60) or a complementary sequence thereof;(3) ATATACCGTCAAGCTTCCACAGCGA (SEQ ID NO.
61) or a complementary sequence thereof; and(4) a modified sequence prepared such that any one of the sequences of SEQ ID NOS. 59 to 61 and the complementary sequences thereof is subjected to base deletion, substitution, or addition as far as the modified sequence retains a function as the probe. - View Dependent Claims (2, 3, 4, 5, 6, 10, 11, 12, 13)
-
-
7. A probe set for detecting a gene of infectious disease pathogenic bacterium, Porphyromonas gingivalis, including at least two probes selected from the following items (A) to (L):
-
(A) a probe having a base sequence represented by TTATAGCTGTAAGATAGGCATGCGTCCC (SEQ ID NO.
59);(B) a probe having a base sequence represented by AACGGGCGATACGAGTATTGCATTGA (SEQ ID NO.
60);(C) a probe having a base sequence represented by ATATACCGTCAAGCTTCCACAGCGA (SEQ ID NO.
61);(D) a probe having a complementary sequence of the base sequence represented by SEQ ID NO. 59; (E) a probe having a complementary sequence of the base sequence represented by SEQ ID NO. 60; (F) a probe having a complementary sequence of the base sequence represented by SEQ ID NO. 61; (G) a probe having a modified sequence obtained by base deletion, substitution, or addition on the base sequence represented by SEQ ID NO. 59 as far as it retains the function of a probe for detecting the gene of Porphyromonas gingivalis;
(H) a probe having a modified sequence obtained by base deletion, substitution, or addition on the base sequence represented by SEQ ID NO. 60 as far as it retains the function of a probe for detecting the gene of Porphyromonas gingivalis;
(I) a probe having a modified sequence obtained by base deletion, substitution, or addition on the base sequence represented by SEQ ID NO. 61 as far as it retains the function of a probe for detecting the gene of Porphyromonas gingivalis;
(J) a probe having a modified sequence obtained by base deletion, substitution, or addition on the complementary sequence of the base sequence represented by SEQ ID NO. 59 as far as it retains the function of a probe for detecting the gene of Porphyromonas gingivalis;
(K) a probe having a modified sequence obtained by base deletion, substitution, or addition on the complementary sequence of the base sequence represented by SEQ ID NO. 60 as far as it retains the function of a probe for detecting the gene of Porphyromonas gingivalis; and (L) a probe having a modified sequence obtained by base deletion, substitution, or addition on the complementary sequence of the base sequence represented by SEQ ID NO. 61 as far as it retains the function of a probe for detecting the gene of Porphyromonas gingivalis. - View Dependent Claims (8, 9)
-
Specification