Immunostimulatory Oligonucleotides

• US 20100143400A1
• Filed: 12/08/2009
• Published: 06/10/2010
• Est. Priority Date: 12/09/2008
• Status: Active Grant

• Current Assignee: Pfizer Inc.
• Original Assignee: Pfizer Inc.
• Inventors: DAVIS, HEATHER, WEERATNA, RISINI
• Granted Patent: US 8,552,165 B2
• Time in Patent Office: Days
• US Class Current: 424/197.110
• CPC Class Codes: A61K 2039/55561 CpG containing adjuvants; Oligonucleotide containing adjuvants
• CPC Class Codes: A61K 39/12 Viral antigens
• CPC Class Codes: A61K 39/145 Orthomyxoviridae, e.g. influenza virus
• CPC Class Codes: A61K 39/292 Serum hepatitis virus, hepatitis B virus, e.g. Australia antigen
• CPC Class Codes: A61K 39/39 characterised by the immunostimulating additives, e.g. chemical adjuvants
• CPC Class Codes: C12N 2730/10134 Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
• CPC Class Codes: C12N 2760/16134 Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
• CPC Class Codes: Y02A 50/30 Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).

Claims

1. An immunostimulatory oligonucleotide comprising the nucleotide sequence

5′

TCGTCGTTTTTCGGTGCTTTT 3′

(SEQ ID NO;

1).

2. The immunostimulatory oligonucleotide of claim 1, wherein the oligonucleotide comprises one or more modified linkages.

3. The immunostimulatory oligonucleotide of claim 2, wherein the oligonucleotide comprises one or more phosphorothioate linkages.

4. The immunostimulatory oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one lipophilic substituted nucleotide analog and a pyrimidine-purine dinucleotide.

5. A vaccine comprising

an antigen and an immunostimulatory oligonucleotide comprising the nucleotide sequence SEQ ID NO:

1, further comprising a pharmaceutically acceptable carrier.

6. The vaccine of claim 5, wherein the immunostimulatory oligonucleotide is in an effective amount to induce an antigen-specific immune response.

7. The vaccine of claim 6, wherein the antigen-specific immune response induced is a Th1 immune response.

8. The vaccine of claim 5, wherein the antigen is a microbial antigen, a self antigen or an addictive substance.

9. The vaccine of claim 8, wherein the microbial antigen is a bacterial antigen, a viral antigen or a parasitic antigen.

10. The vaccine of claim 9, wherein

a) the bacterial antigen is associated with Staphylococcus aureus, a bacterium that causes dental caries, or a bacterium that causes periodontal disease;

b) the viral antigen is associated with Respiratory Syncytial virus (RSV), Herpes Simplex virus 1, Herpes Simplex virus 2, Human Immunodeficiency Virus-1 (HIV-1) or HIV-2;

or

c) the parasitic antigen is associated with a parasite that causes malaria.

17. The vaccine of claim 8, wherein the self antigen is a tumor antigen, an antigen associated with Alzheimer'"'"'s Disease, an antigen against a human antibody, an antigen that is expressed from human endogenous retroviral elements or a nicotine hapten conjugated to a carrier.

18. The vaccine of claim 17, wherein

a) the tumor antigen is HER2, MAGE, NY-ESO, PSA, CEA or a variant form of EGFR;

b) the antigen is associated with Alzheimer'"'"'s Disease is tau or β

-amyloid;

c) the antigen is IgE;

or

d) the carrier to which the nicotine hapten is conjugated is diphtheria toxin (DT).

23. The vaccine of claim 5, wherein the antigen is a peptide, a recombinant protein, a purified protein, whole killed pathogen, live attenuated virus or viral vector, live attenuated bacteria or a bacterial vector, a polysaccharide, a hapten, or encoded by plasmid DNA.

24. The vaccine of claim 5, wherein the antigen is conjugated to a carrier.

25. The vaccine of claim 24, wherein the carrier is diphtheria toxin (DT) or a virus-like particle, wherein the virus-like particle is RNA phage Q-β

, hepatitis B surface antigen (HBsAg), or hepatitis B core antigen (HBcAg).

28. The vaccine of claim 5, further comprising one or more adjuvants.

29. The vaccine of claim 28, wherein the adjuvant is an agonist for a Toll-like receptor (TLR) that is not TLR9.

30. The vaccine of claim 29, wherein the agonist is for TLR 3, TLR 4, TLR 5, TLR 7 or TLR 8.

31. The vaccine of claim 30, wherein

a) the TLR 3 agonist is stabilized polyl:

C;

b) the TLR 4 agonist is a derivative of lipopolysaccharide (LPS);

c) the TLR 5 agonist is flagellin;

or

d) the TLR 7 or 8 agonist is a small molecule of the imidazoquinoline family.

50. The vaccine of claim 5, wherein

a) the vaccine is formulated for administration via a parenteral route, wherein the parental route is intramuscular, subcutaneous, intradermal, intravenous or intraperitoneal;

or

b) the vaccine is formulated for administration via a topical route, wherein the topical route is the skin, transdermal or a mucosal surface.

11-16. -16. (canceled)

19-22. -22. (canceled)

26-27. -27. (canceled)

32-49. -49. (canceled)

51-52. -52. (canceled)

53. A method of inducing an antigen-specific immune response in a subject in need thereof comprising

administering to a subject an antigen and an immunostimulatory oligonucleotide comprising nucleotide sequence SEQ ID NO:

1 in an effective amount to induce an antigen-specific immune response in said subject.

54-104. -104. (canceled)