PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD

• US 20100173316A1
• Filed: 02/01/2010
• Published: 07/08/2010
• Est. Priority Date: 05/14/2007
• Status: Active Grant

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Tomatsu, Nubuhiro, Shimizu, Nobuyoshi, Fukui, Toshifumi, Takayanagi, Atsushi
• Granted Patent: US 8,404,447 B2
• Time in Patent Office: Days
• US Class Current: 435/6
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 2 and mutated sequences thereof.

Claims

1-7. -7. (canceled)

8. A method of specifically detecting a DNA of Arthroderma vanbreuseghemii which is a pathogenic fungus, comprising:

(i) reacting a sample with a probe carrier comprising at least two of the following probes (A) to (H), which are immobilized on a carrier as arranged at intervals, under stringent conditions; and

(ii) detecting a reaction intensity of each probe on the probe carrier reacted with a nucleic acid contained in the sample to detect the DNA of Arthroderma vanbreuseghemii that reacts with all of the at least two probes;

(A) a probe consisting essentially of a base sequence represented by tctctttagtggctcaacgctgga (SEQ ID NO.

     1);

(B) a probe consisting essentially of a base sequence represented by ggacagacgcaaaaaaattctttcagaag (SEQ ID NO.

     2);

(C) a probe consisting essentially of a complementary sequence of SEQ ID NO. 1;

(D) a probe consisting essentially of a complementary sequence of SEQ ID NO. 2;

(E) a probe consisting essentially of a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 1 within a range that the mutated sequence retains a function as a probe for detecting a DNA of Arthroderma vanbreuseghemii;

(F) a probe consisting essentially of a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 2 within a range that the mutated sequence retains the function as a probe for detecting a DNA of Arthroderma vanbreuseghemii;

(G) a probe consisting essentially of a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 1 within a range that the mutated sequence retains the function as a probe for detecting a DNA of Arthroderma vanbreuseghemii;

(H) a probe consisting essentially of a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 2 within a range that the mutated sequence retains the function as a probe for detecting a DNA of Arthroderma vanbreuseghemii.

9. The method according to claim 8, wherein the method uses a kit for specifically detecting a DNA of Arthroderma vanbreuseghemii, the kit comprising:

the probe carrier; and

a reagent for detecting a reaction between each of the at least two probes with a target nucleic acid.

10. The method according to claim 8, wherein the method specifically detects a DNA of Arthroderma vanbreuseghemii, in a sample potentially containing Arthroderma vanbreuseghemii, along with other Arthroderma species, Candida species, Trichosporon species, Cryptococcus species, Aspergillus species, Epidermophyton species, and Trichophyton species.

11. The method according to claim 10, wherein the method specifically detects a DNA of Arthroderma vanbreuseghemii, in a sample potentially containing Arthroderma vanbreuseghemii, along with Candida albicans (JCM 1542), Candida dubliniensis (ATCC MYA-646), Candida glabrata (JCM 3761), Candida guilliermondii (ATCC 6260), Candida intermedia (ATCC 14439), Candida kefyr (ATCC 42265), Candida krusei (JCM 1609), Candida lusitaniae (ATCC 34449), Candida parapsilosis (JCM 1618), Candida tropicalis (JCM 1541), Trichosporon cutaneum (JCM 1462), Trichosporon asahii (JCM 1809), Cryptococcus neoformans (ATCC 32045), Aspergillus fumigatus (JCM 10253), Aspergillus niger (JCM 10254), Epidermophyton floccosum (ATCC 52063), Arthroderma otae (ATCC 28327), Arthroderma gypseum (ATCC 24163), Arthroderma benhamiae (ATCC 16781), Trichophyton rubrum (ATCC 10218), Trichophyton tonsurans (ATCC 10217), Trichophyton verrucosum (ATCC 28203), Trichophyton violaceum (ATCC 28944), Arthroderma incurvatum (ATCC 24005), or Trichophyton interdigitale (IFM 55365).