PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD
0 Assignments
0 Petitions
Accused Products
Abstract
A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.
66 Citations
11 Claims
-
1-7. -7. (canceled)
-
8. A detecting method to detect a nucleic acid of Candida albicans which is a pathogenic fungus comprising the steps of:
-
(i) reacting a sample with a probe carrier on which at least two probes selected from the following (A) to (P) are separately placed under a stringent condition; and (ii) detecting a reaction intensity of probes on the probe carrier reacted with a nucleic acid contained in the sample and judging the presence of Candida albicans in the sample if the nucleic acid reacts with all of the at least two probes selected from (A) to (P); (A) a probe including a base sequence represented by tctttgaaacaaacttgctttggcgg (SEQ ID NO.
1);(B) a probe including a base sequence represented by ccgccagaggtctaaacttacaacc (SEQ ID NO.
2);(C) a probe including a base sequence represented by gacggtagtggtaaggcgggat (SEQ ID NO.
3);(D) a probe including a base sequence represented by ggcggtaacgtccaccacgtat (SEQ ID NO.
4);(E) a probe including a complementary sequence of SEQ ID NO. 1; (F) a probe including a complementary sequence of SEQ ID NO. 2; (G) a probe including a complementary sequence of SEQ ID NO. 3; (H) a probe including a complementary sequence of SEQ ID NO. 4; (I) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 1 within a range that the mutated sequence retains a function as a probe for detecting the nucleic acid of Candida albicans;
(J) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 2 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida albicans;
(K) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 3 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida albicans;
(L) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 4 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida albicans;
(M) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 1 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida albicans;
(N) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 2 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida albicans;
(O) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 3 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida albicans; and (P) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 4 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida albicans. - View Dependent Claims (9, 10, 11)
-
Specification