PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD

• US 20100240053A1
• Filed: 03/02/2010
• Published: 09/23/2010
• Est. Priority Date: 05/14/2007
• Status: Active Grant

• Current Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Original Assignee: Canon Kabushiki Kaisha (Canon Inc.)
• Inventors: Shimizu, Nobuyoshi, Tomatsu, Nobuhiro, Fukui, Toshifumi, Takayanagi, Atsushi
• Granted Patent: US 8,206,912 B2
• Time in Patent Office: Days
• US Class Current: 435/6
• CPC Class Codes: C12Q 1/689 for bacteria
• CPC Class Codes: C12Q 1/6895 for plants, fungi or algae

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.

Claims

1-7. -7. (canceled)

8. A detecting method to detect a nucleic acid of Candida glabrata which is a pathogenic fungus comprising the steps of:

(i) reacting a sample with a probe carrier on which at least two probes selected from the following (A) to (P) are separately placed under a stringent condition; and

(ii) detecting a reaction intensity of probes on the probe carrier reacted with a nucleic acid contained in the sample and judging the presence of Candida glabrata in the sample if the nucleic acid reacts with all of the at least two probes selected from (A) to (P);

(A) a probe including a base sequence represented by ggtgttttatcacacgactcgacact (SEQ ID NO.

     1);

(B) a probe including a base sequence represented by ggagttctcccagtggatgcaaac (SEQ ID NO.

     2);

(C) a probe including a base sequence represented by ggccatatcagtatgtgggacacg (SEQ ID NO.

     3);

(D) a probe including a base sequence represented by aggttttaccaactcggtgttgatctag (SEQ ID NO.

     4);

(E) a probe including a complementary sequence of SEQ ID NO. 1;

(F) a probe including a complementary sequence of SEQ ID NO. 2;

(G) a probe including a complementary sequence of SEQ ID NO. 3;

(H) a probe including a complementary sequence of SEQ ID NO. 4;

(I) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 1 within a range that the mutated sequence retains a function as a probe for detecting the nucleic acid of Candida glabrata;

(J) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 2 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida glabrata;

(K) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 3 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida glabrata;

(L) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 4 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida glabrata;

(M) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 1 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida glabrata;

(N) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 2 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida glabrata;

(O) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 3 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida glabrata; and

(P) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 4 within a range that the mutated sequence retains the function as a probe for detecting the nucleic acid of Candida glabrata.

9. The detecting method of claim 8, wherein the nucleic acid of Candida glabrata is specifically detected from the sample in which a fungus of Candida species other than Candida glabrata or any one fungus selected from Cryptococcus species, Trichosporon species, Aspergillus species, Epidermophyton species, Arthroderma species, and Trichophyton might exist.

10. The detecting method of claim 9, wherein the nucleic acid of Candida glabrata is specifically detected from the sample in which any one selected from Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida intermedia, Candida kefyr, Candida krusei, Candida lusitaniae, Candida parapsilosis, Candida tropicalis, Trichosporon cutaneum, Trichosporon asahii, Cryptococcus neoformans, Aspergillus fumigatus, Aspergillus niger, Epidermophyton floccosum, Arthroderma otae, Arthroderma gypseum, Arthroderma benhamiae, Trichophyton rubrum, Trichophyton tonsurans, Trichophyton verrucosum, Trichophyton violaceum, Arthroderma vanbreuseghemii, Arthroderma incurvatum and Trichophyton interdigitale might exist.

11. The detecting method of claim 8, wherein a kit is used to detect the nucleic acid of Candida glabrata, wherein the kit comprises the probe carrier and a reagent to detect the reaction of a probe with the nucleic acid of Candida glabrata.