METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA

• US 20140221458A1
• Filed: 03/07/2014
• Published: 08/07/2014
• Est. Priority Date: 10/26/2007
• Status: Abandoned Application

• Current Assignee: Prosensa Technologies B.V.
• Original Assignee: Academisch Ziekenhuis Leiden, Prosensa B.V., Prosensa Holding B.V., Prosensa Technologies B.V.
• Inventors: De Kimpe, Josephus Johannes, Aartsma-Rus, Annemieke, Platenburg, Gerard Johannes, Van Deutekom, Judith Christina Theodora, Van Ommen, Garrit-Jan Boudewijn
• Application Number:
  US14/200,251
• Publication Number:
  US 20140221458A1
• Time in Patent Office: Days
• US Class Current: 514/44.A
• CPC Class Codes: A61K 2300/00 Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
• CPC Class Codes: A61K 31/56 Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
• CPC Class Codes: A61K 31/57 substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
• CPC Class Codes: A61K 31/573 substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
• CPC Class Codes: A61K 31/58 containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin digitoxin A61K31/7048
• CPC Class Codes: A61K 31/7088 Compounds having three or more nucleosides or nucleotides
• CPC Class Codes: A61K 38/1719 Muscle proteins, e.g. myosin or actin
• CPC Class Codes: A61K 45/06 Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: A61P 21/02 Muscle relaxants, e.g. for tetanus or cramps
• CPC Class Codes: A61P 21/04 for myasthenia gravis
• CPC Class Codes: A61P 25/28 for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• CPC Class Codes: A61P 29/00 Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• CPC Class Codes: A61P 3/14 for calcium homeostasis vitamin D A61P3/02; parathyroid hormones A61P5/18; calcitonin A61P5/22; osteoporosis A61P19/10; bone metastasis A61P35/04
• CPC Class Codes: A61P 39/06 Free radical scavengers or antioxidants
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/111 spanning the whole gene, or a large part of it
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/313 : Phosphorodithioates
• CPC Class Codes: C12N 2310/314 : Phosphoramidates
• CPC Class Codes: C12N 2310/315 : Phosphorothioates
• CPC Class Codes: C12N 2310/3181 : Peptide nucleic acid, PNA
• CPC Class Codes: C12N 2310/321 : 2'-O-R Modification
• CPC Class Codes: C12N 2310/3231 : having an additional ring, e.g. LNA, ENA
• CPC Class Codes: C12N 2310/3233 : Morpholino-type ring
• CPC Class Codes: C12N 2310/346 : having a combination of backbone and sugar modifications
• CPC Class Codes: C12N 2310/3521 : Methyl
• CPC Class Codes: C12N 2320/31 : Combination therapy
• CPC Class Codes: C12N 2320/33 : Alteration of splicing

Abstract

The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing an isolate muscle cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in the method.

Claims

1. A method for inducing and/or promoting the skipping of exon 45 of the human dystrophin pre-mRNA, said method comprising:

providing an oligonucleotide of 21 to 50 nucleotides in length to a cell, wherein said oligonucleotide comprises a nucleotide sequence which is complementary to a target sequence of exon 45 of the human dystrophin pre-mRNA, wherein said target sequence comprises a nucleotide sequence that is complementary to the sequence UUUGCCGCUGCCCAAUGCCAUCCUG (SEQ ID NO;

     3) and wherein said oligonucleotide induces skipping of said exon in the cell.

3. The method of claim 1, wherein the cell is a muscle cell.

4. The method of claim 1, wherein the cell is from a subject with Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD).

5. The method of claim 1, wherein mRNA produced from skipping of exon 45 of the dystrophin pre-mRNA encodes a functional dystrophin protein or a dystrophin protein of a Becker patient.

6. The method of claim 1, wherein the oligonucleotide comprises DNA.

7. The method of claim 1, wherein the oligonucleotide comprises RNA.

8. The method of claim 1, wherein the nucleotides of the oligonucleotide comprise purine and pyrimidine bases.

9. The method of claim 8, wherein the bases are selected from the group consisting of adenine, cytosine, guanine, thymine, and uracil.

10. The method of claim 1, wherein the oligonucleotide sequence comprises a modified base, and/or a modified sugar moiety, and/or a non-natural internucleoside linkage.

11. The method of claim 10, wherein the oligonucleotide comprises a modified base.

12. The method of claim 1, wherein the oligonucleotide has a modified backbone.

13. The method of claim 10, wherein the oligonucleotide comprises one or more sugar moieties that are mono- or disubstituted at the 2°

, 3′ and

/or 5′

position.

14. The method of claim 10, wherein the oligonucleotide comprises a phosphorothioate internucleoside linkage.

15. The method of claim 14, wherein each internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

16. The method of claim 14, wherein the oligonucleotide comprises a 2′

-O-substituted phosphorothioate antisense oligonucleotide.

17. The method of claim 16, wherein the oligonucleotide comprises a 2′

-O-methyl ribose.

18. The method of claim 17, wherein the oligonucleotide is a 2′

49-methyl phosphorothioate oligonucleotide.

19. The method of claim 1, wherein the oligonucleotide comprises a phosphorothioate antisense oligonucleotide comprising the nucleotide sequence 5′

UUUGCCGGUGCCCAAUGCCAUCCUG 3′

(SEQ ID NO;

     3); and

wherein the sugar moieties are each 2′

-O-methyl substituted.

20. The method of claim 12, wherein the modified backbone is selected from the group consisting of a morpholino backbone, a carbamate backbone, a siloxane backbone, a sulfide backbone, a sulfoxide backbone, a sulfone backbone, a formacetyl backbone, a thioformacetyl backbone, a methyleneformacetyl backbone, a riboacetyl backbone, an alkene containing backbone, a sulfamate backbone, a sulfonate backbone, a sulfonamide backbone, a methyleneimino backbone, a methylenehydrazino backbone and an amide backbone.

21. The method of claim 10, wherein the oligonucleotide comprises a phosphorodiamidate internucleoside linkage.

22. The method of claim 21, wherein each internucleoside linkage of the oligonucleotide is a phosphorodiamidate internucleoside linkage.

23. The method of claim 22, wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide.

24. The method of claim 1, wherein the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acid, and/or locked nucleic acid.

25. The method of claim 1, wherein the oligonucleotide comprises a phosphorothioate internucleoside linkage, a 2′

-O-methyl ribose and/or a locked nucleic acid.

26. The method of claim 1, wherein the oligonucleotide induces exon 45 skipping in the human dystrophin pre-mRNA and dystrophin expression at the muscle cell membrane upon transfection of human muscle cells with a concentration between 0.1 nM and 1 μ

M of said oligonucleotide and incubation for at least 16 hours.

27. The method of claim 1, wherein exon 45 skipping is detected by RT-PCR and/or sequence analysis.

28. The method of claim 26, wherein dystrophin expression at the muscle cell membrane is detected by immunohistochemical and/or western blot analysis.

2. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) in a patient by inducing the skipping of exon 45 of the human dystrophin pre-mRNA, said method comprising:

providing an oligonucleotide of 21 to 50 nucleotides in length to a cell, wherein said oligonucleotide comprises a nucleotide sequence which is complementary to a target sequence of exon 45 of the human dystrophin pre-mRNA, wherein said target sequence comprises a nucleotide sequence that is complementary to the sequence UUUGCCGCUGCCCAAUGCCAUCCUG (SEQ ID NO;

     3) and wherein said oligonucleotide induces skipping of said exon in the cell.