METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA

• US 20150073037A1
• Filed: 11/14/2014
• Published: 03/12/2015
• Est. Priority Date: 10/26/2007
• Status: Active Grant

• Current Assignee: Academisch Ziekenhuis Leiden, BioMarin Technologies B.V.
• Original Assignee: Prosensa Technologies B.V.
• Inventors: De Kimpe, Josephus Johannes, Aartsma-Rus, Annemieke, Platenburg, Gerard Johannes, Van Deutekom, Judith Christina Theodora, Van Ommen, Garrit-Jan Boudewijn
• Granted Patent: US 9,528,109 B2
• Time in Patent Office: Days
• US Class Current: 514/44.A
• CPC Class Codes: A61K 2300/00 Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
• CPC Class Codes: A61K 31/56 Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
• CPC Class Codes: A61K 31/57 substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
• CPC Class Codes: A61K 31/573 substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
• CPC Class Codes: A61K 31/58 containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin digitoxin A61K31/7048
• CPC Class Codes: A61K 31/7088 Compounds having three or more nucleosides or nucleotides
• CPC Class Codes: A61K 38/1719 Muscle proteins, e.g. myosin or actin
• CPC Class Codes: A61K 45/06 Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: A61P 21/02 Muscle relaxants, e.g. for tetanus or cramps
• CPC Class Codes: A61P 21/04 for myasthenia gravis
• CPC Class Codes: A61P 25/28 for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• CPC Class Codes: A61P 29/00 Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• CPC Class Codes: A61P 3/14 for calcium homeostasis vitamin D A61P3/02; parathyroid hormones A61P5/18; calcitonin A61P5/22; osteoporosis A61P19/10; bone metastasis A61P35/04
• CPC Class Codes: A61P 39/06 Free radical scavengers or antioxidants
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/111 spanning the whole gene, or a large part of it
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/313 : Phosphorodithioates
• CPC Class Codes: C12N 2310/314 : Phosphoramidates
• CPC Class Codes: C12N 2310/315 : Phosphorothioates
• CPC Class Codes: C12N 2310/3181 : Peptide nucleic acid, PNA
• CPC Class Codes: C12N 2310/321 : 2'-O-R Modification
• CPC Class Codes: C12N 2310/3231 : having an additional ring, e.g. LNA, ENA
• CPC Class Codes: C12N 2310/3233 : Morpholino-type ring
• CPC Class Codes: C12N 2310/346 : having a combination of backbone and sugar modifications
• CPC Class Codes: C12N 2310/3521 : Methyl
• CPC Class Codes: C12N 2320/31 : Combination therapy
• CPC Class Codes: C12N 2320/33 : Alteration of splicing

Abstract

The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing an isolate muscle cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in the method.

Claims

1. An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides, wherein said oligonucleotide is complementary along its entire length to a sequence within the human dystrophin exon 45 pre-mRNA, wherein said sequence is also complementary to at least 22 nucleotides of a sequence consisting of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID NO;

     3).

2. The oligonucleotide of claim 1, wherein said oligonucleotide comprises a phosphorothioate internucleoside linkage and a 2′

-O-alkyl substituted ribose moiety.

3. The oligonucleotide of claim 1, wherein said oligonucleotide induces skipping of exon 45.

8. A viral-based vector comprising an expression cassette comprising a nucleotide sequence encoding the oligonucleotide of claim 1.

9. A pharmaceutical composition comprising the oligonucleotide of claim 1, and a pharmaceutically acceptable carrier.

10. The oligonucleotide of claim 1, wherein the oligonucleotide comprises a nucleotide analogue, wherein the nucleotide analogue comprises a modified base, and/or a modified sugar moiety, and/or a modified internucleoside linkage.

11. The oligonucleotide of claim 1, comprising a modified backbone.

16. The oligonucleotide of claim 11, wherein the modified backbone is selected from the group consisting of a morpholino backbone, a carbamate backbone, a siloxane backbone, a sulfide backbone, a sulfoxide backbone, a sulfone backbone, a formacetyl backbone, a thioformacetyl backbone, a methyleneformacetyl backbone, a riboacetyl backbone, an alkene containing backbone, a sulfamate backbone, a sulfonate backbone, a sulfonamide backbone, a methyleneimino backbone, a methylenehydrazino backbone and an amide backbone.

17. The oligonucleotide of claim 1, wherein the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acid, and/or locked nucleic acid.

18. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.

19. The pharmaceutical composition of claim 18, further comprising a molecule which induces or promotes skipping of exon 7, 44, 46, 51, 53, 59, or 67 of dystrophin pre-mRNA of a patient.

20. The oligonucleotide of claim 1, wherein the oligonucleotide consists of 22, 23, 24, or 25 nucleotides.

21. The oligonucleotide of claim 1, wherein the oligonucleotide consists of 25, 26, 27, 28, or 29 nucleotides.

22. The oligonucleotide of claim 1, wherein the oligonucleotide consists of 25 nucleotides.

23. The oligonucleotide of claim 1, wherein the nucleotides of said oligonucleotide comprise purine and pyrimidine bases.

24. The oligonucleotide of claim 23, wherein the bases are selected from the group consisting of:

adenine, cytosine, guanine, thymine and uracil.

30. The oligonucleotide of claim 21, wherein the oligonucleotide comprises the base sequence of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID;

NO;

     3).

32. The oligonucleotide of claim 1, wherein the oligonucleotide induces exon 45 skipping with an efficiency of at least 50%.

43. The oligonucleotide of claim 10, wherein the nucleotide analogue comprises a modified internucleoside linkage.

48. The oligonucleotide of claim 1, wherein the bases of the oligonucleotide consist of DNA bases or RNA bases.

51. The method of claim 1, wherein the cell is a muscle cell.

52. The method of claim 1, wherein the cell is from a subject with Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD).

53. The method of claim 1, wherein mRNA produced from skipping of exon 45 of the dystrophin pre-mRNA encodes a functional dystrophin protein or a dystrophin protein of a Becker patient.

54. The method of claim 1, wherein the oligonucleotide comprises DNA.

55. The method of claim 1, wherein the oligonucleotide comprises RNA.

56. The method of claim 1, wherein the nucleotides of the oligonucleotide comprise purine and pyrimidine bases.

57. The method of claim 8, wherein the bases are selected from the group consisting of:

adenine, cytosine, guanine, thymine, and uracil.

58. The method of claim 1, wherein the oligonucleotide sequence comprises a modified base, and/or a modified sugar moiety, and/or a non-natural internucleoside linkage.

59. The method of claim 10, wherein the oligonucleotide comprises a modified base.

60. The method of claim 1, wherein the oligonucleotide has a modified backbone.

61. The method of claim 10, wherein the oligonucleotide comprises one or more sugar moieties that are mono- or disubstituted at the 2′

, 3′ and

/or 5′

position.

62. The method of claim 10, wherein the oligonucleotide comprises a phosphorothioate internucleoside linkage.

65. The method of claim 16, wherein the oligonucleotide comprises a 2′

-O-methyl ribose.

66. The method of claim 17, wherein the oligonucleotide is a 2′

-O-methyl phosphorothioate oligonucleotide.

67. The method of claim 1, wherein the oligonucleotide comprises a phosphorothioate antisense oligonucleotide comprising the nucleotide sequence 5′

UUUGCCGCUGCCCAAUGCCAUCCUG 3′

(SEQ ID NO;

     3); and

wherein the sugar moieties are each 2′

-O-methyl substituted.

69. The method of claim 10, wherein the oligonucleotide comprises a phosphorodiamidate internucleoside linkage.

70. The method of claim 21, wherein each internucleoside linkage of the oligonucleotide is a phosphorodiamidate internucleoside linkage.

71. The method of claim 22, wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide.

72. The method of claim 1, wherein the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acid, and/or locked nucleic acid.

73. The method of claim 1, wherein the oligonucleotide comprises a phosphorothioate internucleoside linkage, a 2′

-O-methyl ribose and/or a locked nucleic acid.

74. The method of claim 1, wherein the oligonucleotide induces exon 45 skipping in the human dystrophin pre-mRNA and dystrophin expression at the muscle cell membrane upon transfection of human muscle cells with a concentration between 0.1 nM and 1 □

M of said oligonucleotide and incubation for at least 16 hours.

75. The method of claim 1, wherein exon 45 skipping is detected by RT-PCR and/or sequence analysis.

4. An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides, wherein said oligonucleotide is complementary along its entire length to a sequence within the human dystrophin exon 45 pre-mRNA, wherein said sequence is also complementary to at least 22 nucleotides of a sequence consisting of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID NO;

     3), wherein the oligonucleotide comprises a modified base, and/or a modified sugar moiety, and/or a modified internucleoside linkage.

5. The oligonucleotide of claim 4, wherein the modified sugar moiety is a ribose that is mono- or di-substituted at the 2′

, 3′

, and/or 5′

position.

12. The oligonucleotide of claim 5, wherein the ribose is a 2′

-O-substituted ribose.

13. The oligonucleotide of claim 12, wherein the ribose is a 2′

-O methyl ribose.

14. The oligonucleotide of claim 4, wherein each sugar moiety of the oligonucleotide comprises a 2′

-O-methyl substitution and each internucleoside linkage of said oligonucleotide comprises a phosphorothioate moiety.

25. The oligonucleotide of claim 4, wherein the oligonucleotide consists of 22, 23, 24, or 25 nucleotides.

26. The oligonucleotide of claim 4, wherein the oligonucleotide consists of 25, 26, 27, 28, or 29 nucleotides.

27. The oligonucleotide of claim 4, wherein the oligonucleotide consists of 25 nucleotides.

28. The oligonucleotide of claim 4, wherein the nucleotides of said oligonucleotide comprise purine and pyrimidine bases.

29. The oligonucleotide of claim 28, wherein the bases are selected from the group consisting of:

adenine, cytosine, guanine, thymine and uracil.

31. The oligonucleotide of claim 25, wherein the oligonucleotide comprises the base sequence of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID;

NO;

     3).

63. The method of claim 14, wherein each internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

64. The method of claim 14, wherein the oligonucleotide comprises a 2′

-O-substituted phosphorothioate antisense oligonucleotide.

68. The method of claim 12, wherein the modified backbone is selected from the group consisting of a morpholino backbone, a carbamate backbone, a siloxane backbone, a sulfide backbone, a sulfoxide backbone, a sulfone backbone, a formacetyl backbone, a thioformacetyl backbone, a methyleneformacetyl backbone, a riboacetyl backbone, an alkene containing backbone, a sulfamate backbone, a sulfonate backbone, a sulfonamide backbone, a methyleneimino backbone, a methylenehydrazino backbone and an amide backbone.

76. The method of claim 26, wherein dystrophin expression at the muscle cell membrane is detected by immunohistochemical and/or western blot analysis.

6. An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides, wherein said oligonucleotide is complementary along its entire length to a sequence within the human dystrophin exon 45 pre-mRNA, wherein said sequence is also complementary to at least 22 nucleotides of a sequence consisting of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID NO;

     3), wherein the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acid, and/or locked nucleic acid.

7. An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides, wherein said oligonucleotide is capable of binding to a continuous stretch of nucleotides within the human dystrophin exon 45 pre-mRNA, and wherein PS220 (5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

) (SEQ ID NO;

     3) is capable of binding to said continuous stretch of nucleotides.

15. An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides, wherein said oligonucleotide is complementary along its entire length to a sequence in part of the human dystrophin exon 45 pre-mRNA, wherein said sequence is complementary to at least 22 nucleotides of a sequence consisting of 5′

UUUGCCGCUGCCCAAUGCCAUCCUG 3′

(SEQ ID NO;

3);

wherein each sugar moiety of the oligonucleotide is 2′

-O-methyl substituted and each of the internucleoside linkages present in the oligonucleotide comprises a phosphorothioate moiety.

33. An oligomer for ameliorating DMD, the oligomer consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides, comprising at least 22 nucleotides of the base sequence of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID;

NO;

     3);

wherein the bases of the oligomer are selected from the group consisting of;

adenine, cytosine, guanine, thymine and uracil; and

wherein the molecule can bind to a target site to cause exon skipping in an exon of the dystrophin gene.

34. The oligomer of claim 33, wherein the oligomer consists of 22, 23, 24, or 25 nucleotides.

35. The oligomer of claim 33, wherein the oligomer consists of 25, 26, 27, 28, or 29 nucleotides.

36. The oligomer of claim 33, wherein the oligomer consists of 25 nucleotides.

37. An oligomer for alleviating DMD, the oligomer consisting of 25 nucleotides, and consisting of the sequence 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID;

NO;

     3);

wherein the molecule can bind to a target site to cause exon skipping in an exon of the dystrophin gene.

38. An isolated antisense oligomer whose base sequence consists of the base sequence of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID;

NO;

     3).

40. The oligomer of claim 38, wherein the oligonucleotide consists of 22, 23, 24, or 25 nucleotides.

41. The oligomer of claim 38, wherein the oligonucleotide consists of 25, 26, 27, 28, or 29 nucleotides.

42. The oligomer of claim 38, wherein the oligomer consists of 25 nucleotides.

39. An isolated antisense oligomer consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides comprising at least 22 nucleotides of the base sequence of 5′

-UUUGCCGCUGCCCAAUGCCAUCCUG-3′

(SEQ ID;

NO;

     3).

44. An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides, wherein said oligonucleotide is complementary to at least 22 nucleotides of a sequence consisting of 5′

UUUGCCGCUGCCCAAUGCCAUCCUG 3′

(SEQ ID NO;

3).

46. The oligonucleotide of claim 44, wherein each substituted sugar moiety of the oligonucleotide is 2′

-O-methyl substituted.

47. The oligonucleotide of claim 44, wherein each internucleoside linkage of the oligonucleotide is a phosporothioate linkage.

45. An isolated antisense oligonucleotide, consisting of 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides, wherein said oligonucleotide is complementary to at least 22 nucleotides of a sequence consisting of 5′

UUUGCCGCUGCCCAAUGCCAUCCUG 3′

(SEQ ID NO;

3);

wherein said oligonucleotide comprises at least one 2′

-O-methyl substituted sugar moiety and at least one internucleoside linkage.

49. A method for inducing and/or promoting the skipping of exon 45 of the human dystrophin pre-mRNA, said method comprising:

providing an oligonucleotide of 21 to 50 nucleotides in length to a cell, wherein said oligonucleotide comprises a nucleotide sequence which is complementary to a target sequence of exon 45 of the human dystrophin pre-mRNA, wherein said target sequence comprises a nucleotide sequence that is complementary to the sequence UUUGCCGCUGCCCAAUGCCAUCCUG (SEQ ID NO;

     3) and wherein said oligonucleotide induces skipping of said exon in the cell.

50. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) in a patient by inducing the skipping of exon 45 of the human dystrophin pre-mRNA, said method comprising:

providing an oligonucleotide of 21 to 50 nucleotides in length to a cell, wherein said oligonucleotide comprises a nucleotide sequence which is complementary to a target sequence of exon 45 of the human dystrophin pre-mRNA, wherein said target sequence comprises a nucleotide sequence that is complementary to the sequence UUUGCCGCUGCCCAAUGCCAUCCUG (SEQ ID NO;

     3) and wherein said oligonucleotide induces skipping of said exon in the cell.