MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE

• US 20150080563A2
• Filed: 07/16/2012
• Published: 03/19/2015
• Est. Priority Date: 03/21/2003
• Status: Active Grant

• Current Assignee: Academisch Ziekenhuis Leiden
• Original Assignee: Academisch Ziekenhuis Leiden
• Inventors: van Deutekom, Judith Christina Theodora
• Granted Patent: US 10,100,304 B2
• Time in Patent Office: Days
• US Class Current: 536/24.5
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61K 48/0016 wherein the nucleic acid is delivered as a 'naked' nucleic acid, i.e. not combined with an entity such as a cationic lipid
• CPC Class Codes: A61P 21/00 Drugs for disorders of the muscular or neuromuscular system
• CPC Class Codes: A61P 21/04 for myasthenia gravis
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C07H 21/02 with ribosyl as saccharide radical
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/111 spanning the whole gene, or a large part of it
• CPC Class Codes: C12N 2310/31 of the backbone
• CPC Class Codes: C12N 2310/314 Phosphoramidates
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: C12N 2310/3181 Peptide nucleic acid, PNA
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/3231 having an additional ring, e.g. LNA, ENA
• CPC Class Codes: C12N 2310/3233 Morpholino-type ring
• CPC Class Codes: C12N 2310/346 having a combination of backbone and sugar modifications
• CPC Class Codes: C12N 2310/3521 Methyl
• CPC Class Codes: C12N 2320/30 : Special therapeutic applications
• CPC Class Codes: C12N 2320/33 : Alteration of splicing
• CPC Class Codes: C12Q 1/6883 : for diseases caused by alterations of genetic material
• CPC Class Codes: G01N 33/6887 : from muscle, cartilage or connective tissue

Abstract

The invention relates to oligonucleotides for inducing skipping of exon 55 of the dystrophin gene. The invention also relates to methods of inducing exon 55 skipping using the oligonucleotides.

Claims

1-10. -10. (canceled)

11. An isolated antisense oligonucleotide of 20 to 50 nucleotides in length, comprising a morpholine ring, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skipping of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:

27) is capable of binding to said exon-internal sequence.

12. The oligonucleotide of claim 11, 15, 19, or 26, said exon-internal sequence comprising a consecutive part of between 16 and 50 nucleotides of said exon and wherein said oligonucleotide is complementary to said consecutive part.

14. The oligonucleotide of claim 11, wherein said oligonucleotide further comprises a phosphorodiamidate internucleoside linkage.

18. The oligonucleotide of claim 11 or 17, wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide.

23. The oligonucleotide of claim 11, 15 or 19, wherein the oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA and dystrophin expression in the muscle cell upon transfection of human muscle cells with at least 100 nM of said oligonucleotide and incubation for at least 16 hours.

24. The antisense oligonucleotide of claim 23, wherein exon 51 skipping is detected by RT-PCR and/or sequence analysis.

25. The oligonucleotide of claim 23, wherein dystrophin expression in the muscle cell is detected by immunohistochemical and/or western blot analysis.

27. The oligonucleotide of claim 11, 15, 19 or 26 wherein the bases of said nucleotides of said oligonucleotide consist of DNA bases or RNA bases.

28. The oligonucleotide of claim 11, 15, 19 or 26, said oligonucleotide being less than 50 nucleotides in length.

29. The oligonucleotide of claim 11, 15, 19 or 26, wherein said oligonucleotide is capable of binding without mismatches to said exon-internal sequence.

13. (canceled)

15. An isolated antisense oligonucleotide of 20 to 50 nucleotides in length, comprising a peptide nucleic acid and/or locked nucleic acid, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skipping of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:

27) is capable of binding to said exon-internal sequence.

17. The oligonucleotide of claim 15, wherein each linkage is a phosphorodiamidate internucleoside linkage.

16. (canceled)

19. An isolated antisense oligonucleotide of 20 to 50 nucleotides in length, comprising a 2′

-O-methyl ribose moiety, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skipping of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO;

     27) is capable of binding to said exon-internal sequence.

20. The oligonucleotide of claim 19, further comprising a phosphorothioate internucleoside linkage.

21. The oligonucleotide of claim 19 wherein each internucleoside linkage is a phosphorothioate linkage.

22. The oligonucleotide of claim 19, wherein said oligonucleotide is a 2′

-O-methyl phosphorothioate oligonucleotide.

26. An isolated antisense oligonucleotide of 20 to 50 nucleotides in length, comprising a modification which confers increased resistance to RNAseH, wherein said oligonucleotide is capable of binding to an exon-internal sequence of exon 51 of the human dystrophin pre-mRNA and inducing skipping of exon 51, wherein h51AON1 (UCAAGGAAGAUGGCAUUUCU) (SEQ ID NO:

27) is capable of binding to said exon-internal sequence.