INDUCTION OF EXON SKIPPING IN EUKARYOTIC CELLS

• US 20150361424A1
• Filed: 08/28/2015
• Published: 12/17/2015
• Est. Priority Date: 09/21/2000
• Status: Abandoned Application

• Current Assignee: Academisch Ziekenhuis Leiden
• Original Assignee: Academisch Ziekenhuis Leiden
• Inventors: van Deutekom, Judith Christina Theodora
• Application Number:
  US14/839,200
• Publication Number:
  US 20150361424A1
• Time in Patent Office: Days
• US Class Current: 1/1
• CPC Class Codes: A01K 2267/03 Animal model, e.g. for test or diseases
• CPC Class Codes: A61K 31/7088 Compounds having three or more nucleosides or nucleotides
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61K 48/005 characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• CPC Class Codes: A61K 9/127 Liposomes
• CPC Class Codes: A61P 19/04 for non-specific disorders of the connective tissue
• CPC Class Codes: A61P 21/04 for myasthenia gravis
• CPC Class Codes: A61P 25/00 Drugs for disorders of the nervous system
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 35/04 specific for metastasis
• CPC Class Codes: A61P 5/14 of the thyroid hormones, e.g. T3, T4
• CPC Class Codes: A61P 7/04 Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
• CPC Class Codes: C12N 15/11 DNA or RNA fragments; Modified forms thereof DNA or RNA not used in recombinant technology, C07H21/00; Non-coding nucleic acids having a biological activity
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/86 Viral vectors
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/315 Phosphorothioates
• CPC Class Codes: C12N 2310/321 2'-O-R Modification
• CPC Class Codes: C12N 2310/346 having a combination of backbone and sugar modifications
• CPC Class Codes: C12N 2310/3521 : Methyl
• CPC Class Codes: C12N 2320/33 : Alteration of splicing
• CPC Class Codes: C12N 2750/14142 : virus or viral particle as vehicle, e.g. encapsulating small organic molecule

Abstract

The present invention provides a method for at least in part decreasing the production of an aberrant protein in a cell, the cell comprising pre-mRNA comprising exons coding for the protein, by inducing so-call exon skipping in the cell. Exon-skipping results in mature mRNA that does not contain the skipped exon, which leads to an altered product of the exon codes for amino acids. Exon skipping is performed by providing a cell with an agent capable of specifically inhibiting an exon inclusion signal, for instance, an exon recognition sequence, of the exon. The exon inclusion signal can be interfered with by a nucleic acid comprising complementarity to a part of the exon. The nucleic acid, which is also herewith provided, can be used for the preparation of a medicament, for instance, for the treatment of an inherited disease.

Claims

6. An antisense-oligonucleotide comprising a nucleic acid sequence selected from the group consisting of

1. A nucleic acid delivery vehicle comprising a liposome and the antisense oligonucleotide of claim 6, or the complement thereof.

2. A nucleic acid delivery vehicle comprising or expressing the antisense oligonucleotide of claim 6.

3. A non-human animal provided with the compound of claim 6.

7. The antisense-oligonucleotide of claim 6, containing 14-40 nucleotides.

8. A nucleic acid delivery vehicle comprising a transcription unit capable of expressing the antisense-oligonucleotide of claim 6.

9. The nucleic acid delivery vehicle of claim 8, wherein the nucleic acid delivery vehicle is a single stranded virus.

10. The nucleic acid delivery vehicle of claim 9, wherein said single stranded virus comprises an adeno-associated virus.

11. An antisense oligonucleotide consisting of hAON#29:

5′

TGATATCCTCAAGGTCACCC (SEQ ID NO;

     24), comprising a modification for increasing its resistance to an endonucleases in a cell.

13. An antisense oligonucleotide consisting of 14 to 40 nucleotides, comprising a modification, said oligonucleotide being complementary only to the interior of an exon selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53 of a dystrophin pre-mRNA, wherein said oligonucleotide induces skipping of said exon in a muscle cell of a Duchenne muscular dystrophy patient or a Becker Muscular Dystrophy patient.

4. The composition of claim 15, wherein the oligonucleotide consists of between 15 to 25 nucleotides.

12. The oligonucleotide of claim 13, wherein said oligonucleotide is a 2′

-O-methyl phosphorothioate oligoribonucleotide or a peptide nucleic acid.

14. The oligonucleotide of claim 13, wherein the modification confers resistance to an endonuclease.

15. A composition comprising the oligonucleotide of claim 13.

16. The composition of claim 15, further comprising a second antisense oligonucleotide consisting of 14 to 40 nucleotides comprising a modification, said oligonucleotide being complementary only to the interior of an exon selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53 of a dystrophin pre-mRNA, wherein said oligonucleotide induces skipping of said exon in a muscle cell of a Duchenne muscular dystrophy patient or a Becker muscular dystrophy patient.

18. The oligonucleotide of claim 13, wherein said oligonucleotide comprises a modified base, and/or a modified sugar moiety and/or a modified internucleoside linkage.

19. A pharmaceutical formulation comprising the oligonucleotide of claim 13 and a pharmaceutically acceptable vehicle.

20. The pharmaceutical formulation of claim 19, wherein said oligonucleotide does not comprise a detectable label.

21. The oligonucleotide of claim 13, where said oligonucleotide comprises a sequence complementary to an exon recognition sequence.

22. A nucleic acid delivery vehicle comprising a packaging agent and the antisense oligonucleotide of claim 13, or the complement thereof.

17. A nucleic acid delivery vehicle comprising a transcription unit expressing an antisense oligonucleotide consisting of 14 to 40 nucleotides said oligonucleotide being complementary only to the interior of an exon selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53 of a dystrophin pre-mRNA, wherein said oligonucleotide induces skipping of said exon in a muscle cell of a Duchenne muscular dystrophy patient or a Becker Muscular Dystrophy patient.

5. The nucleic acid delivery vehicle of claim 17, wherein the oligonucleotide consists of between 15 to 25 nucleotides.

23. A method for directing splicing of a dystrophin pre-mRNA in a muscle cell of a Duchenne muscular dystrophy patient or a Becker muscular dystrophy patient to produce a dystrophin protein comprising:

providing said muscle cell with an antisense oligonucleotide consisting of 14-40 nucleotides,

wherein said oligonucleotide consists of a sequence complementary only to the interior of an exon of the dystrophin pre-mRNA selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53, and

wherein said oligonucleotide induces skipping of said exon of said dystrophin pre-mRNA in said muscle cell.

24. The method of claim 23, wherein the dystrophin pre-mRNA comprises a deletion of one or more exons selected from the group consisting of:

exons 3-7, exons 4-7, exons 5-7, exons 6-7, exons 18-44, exons 35-43, exon 44, exons 44-47, exon 45, exons 45-54, exons 45-52, exon 50, exons 50-52, exons 45-50, exons 46-47, exons 46-48, exons 46-49, exons 46-51, exons 46-53, exons 48-52, exons 48-50, exons 49-50, exons 49-52, exon 52, exons 52-63, exon 51, exons 51-55, exon 53, and exons 53-55.

25. The method of claim 23, wherein mRNA produced from skipping of an exon of the dystrophin pre-mRNA encodes a functional dystrophin protein.

26. The method of claim 25, wherein the functional dystrophin protein comprises a mutant dystrophin protein or a wild type dystrophin protein produced from translation of said mRNA.

27. The method of claim 26, wherein the mutant dystrophin protein is a dystrophin protein of a Becker muscular dystrophy patient.

28. The method of claim 23, wherein the oligonucleotide comprises a modification.

29. The method of claim 23, wherein the oligonucleotide is a 2′

-O-methyl phosphorothioate oligoribonucleotide or a peptide nucleic acid.

30. The method of claim 23, wherein the oligonucleotide is a 2′

-O-methyl-oligoribonucleotide and/or a 2′

-O-methyl-phosphorothioate oligoribonucleotide.

31. The method of claim 23, wherein the oligonucleotide comprises a modified base, and/or a modified sugar moiety and/or a modified internucleoside linkage.