MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD
1 Assignment
0 Petitions
Accused Products
Abstract
Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.
26 Citations
73 Claims
-
1-65. -65. (canceled)
-
66. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:
- 285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping;
or a pharmaceutically acceptable salt thereof. - View Dependent Claims (70)
- 285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′
-
67. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:
- 285), in which;
(i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping;
or a pharmaceutically acceptable salt thereof. - View Dependent Claims (71)
- 285), in which;
-
68. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:
- 285), in which;
(i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping;
or a pharmaceutically acceptable salt thereof. - View Dependent Claims (72)
- 285), in which;
-
69. An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:
- 285), in which;
(i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping;
or a pharmaceutically acceptable salt thereof. - View Dependent Claims (73)
- 285), in which;
Specification