ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF
1 Assignment
0 Petitions
Accused Products
Abstract
An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202.
38 Citations
24 Claims
-
1-20. -20. (canceled)
-
21. An antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO:
- 207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;
or a pharmaceutically acceptable salt thereof.
- 207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-
22. An antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO:
- 207), wherein the antisense oligonucleotide is a 2′
-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;
or a pharmaceutically acceptable salt thereof.
- 207), wherein the antisense oligonucleotide is a 2′
-
23. A pharmaceutical composition comprising:
-
(a) an antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO;
207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′
-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;
or a pharmaceutically acceptable salt thereof, and(b) a pharmaceutically acceptable carrier.
-
-
24. A pharmaceutical composition comprising:
-
(a) an antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO;
207), wherein the antisense oligonucleotide is a 2′
-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping;
or a pharmaceutically acceptable salt thereof, and(b) a pharmaceutically acceptable carrier.
-
Specification