Using Truncated Guide RNAs (tru-gRNAs) to Increase Specificity for RNA-Guided Genome Editing

• US 20160024523A1
• Filed: 03/14/2014
• Published: 01/28/2016
• Est. Priority Date: 03/15/2013
• Status: Active Grant

• Current Assignee: The General Hospital Corporation (Mass General Brigham, Inc.)
• Original Assignee: The General Hospital Corporation (Mass General Brigham, Inc.)
• Inventors: Joung, J. Keith, Sander, Jeffry D., Maeder, Morgan, Fu, Yan-fang
• Granted Patent: US 10,119,133 B2
• Time in Patent Office: Days
• US Class Current: 1/1
• CPC Class Codes: C07K 14/005 from viruses
• CPC Class Codes: C07K 14/195 from bacteria
• CPC Class Codes: C07K 2319/00 Fusion polypeptide
• CPC Class Codes: C07K 2319/01 containing a localisation/targetting motif
• CPC Class Codes: C07K 2319/80 containing a DNA binding domain, e.g. Lacl or Tet-repressor
• CPC Class Codes: C12N 15/01 Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/1031 mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
• CPC Class Codes: C12N 15/11 DNA or RNA fragments; Modified forms thereof DNA or RNA not used in recombinant technology, C07H21/00; Non-coding nucleic acids having a biological activity
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/20 involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2710/00033 Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
• CPC Class Codes: C12N 2770/00033 Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
• CPC Class Codes: C12N 2800/80 Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/0071 acting on paired donors with incorporation of molecular oxygen (1.14)
• CPC Class Codes: C12N 9/1007 Methyltransferases (general) (2.1.1.)
• CPC Class Codes: C12N 9/16 acting on ester bonds (3.1)
• CPC Class Codes: C12N 9/22 Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12N 9/96 : Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
• CPC Class Codes: C12Y 114/11 : with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
• CPC Class Codes: C12Y 201/01 : Methyltransferases (2.1.1)
• CPC Class Codes: C12Y 301/00 : Hydrolases acting on ester bonds (3.1)
• CPC Class Codes: C12Y 301/21004 : Type II site-specific deoxyribonuclease (3.1.21.4)

Abstract

CRISPR-Cas genome editing uses a guide RNA, which includes both a complementarity region, which binds the target DNA by base-pairing, and a Cas9-binding region, to direct a Cas9 nuclease to a target DNA. Further disclosed are methods for increasing specificity of RNA-guided genome editing using CRISPR/Cas9 systems by using truncated guide RNAs (tru-gRNAs).

Claims

1. A method of increasing specificity of RNA-guided genome editing in a cell, the method comprising contacting the cell with a guide RNA that includes a complementarity region consisting of 17-18 nucleotides that are complementary to 17-18 consecutive nucleotides of the complementary strand of a selected target genomic sequence.

4. The method of claim 1, wherein the guide RNA is

(i) a single guide RNA that includes a complementarity region consisting of 17-18 nucleotides that are complementary to 17-18 consecutive nucleotides of the complementary strand of a selected target genomic sequence, or

(ii) a crRNA that includes a complementarity region consisting of 17-18 nucleotides that are complementary to 17-18 consecutive nucleotides of the complementary strand of a selected target genomic sequence, and a tracrRNA.

5. The method of claim 1, wherein the guide RNA is or comprises a ribonucleic acid selected from the group consisting of:

10. The method of claim 5, wherein the ribonucleic acid includes one or more U at the 3′

end of the molecule.

11. The method of claim 5, wherein the ribonucleic acid includes one or more additional nucleotides at the 5′

end of the RNA molecule that is not complementary to the target sequence.

12. The method of claim 5, wherein the ribonucleic acid includes one, two, or three additional nucleotides at the 5′

end of the RNA molecule that are not complementary to the target sequence.

13. The method of claim 1, wherein the complementarity region is complementary to 17 consecutive nucleotides of the complementary strand of a selected target sequence.

14. The method of claim 1, wherein the complementarity region is complementary to 18 consecutive nucleotides of the complementary strand of a selected target sequence.

18. The method of claim 1, wherein the target region is in a target genomic sequence.

19. The method of claim 1, wherein the target genomic sequence is immediately 5′

of a protospacer adjacent motif (PAM).

20. The method of claim 4, wherein the cRNA is (X_17-18 or X_17-19)GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:

2407) and the tracrRNA is GGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO;

8);

the cRNA is (X_17-18 or X_17-19)GUUUUAGAGCUA (SEQ ID NO;

2404) and the tracrRNA is UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGC (SEQ ID NO;

2405);

or the cRNA is (X_17-18 or X_17-19) GUUUUAGAGCUAUGCU (SEQ ID NO;

2408) and the tracrRNA is AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC (SEQ ID NO;

2406).

26. The method of claim 1, which results in an indel mutation or sequence alteration in the selected target genomic sequence.

27. The method of claim 1, wherein the cell is a eukaryotic cell.

28. The method of claim 27, wherein the cell is a mammalian cell.

29. The method of claim 4, wherein the tracrRNA consists of the sequence

GGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:

8), or an active portion thereof;

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGC (SEQ ID NO;

2405) or an active portion thereof;

AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC (SEQ ID NO;

2407) or an active portion thereof;

CAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGC (SEQ ID NO;

2409) or an active portion thereof;

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG (SEQ ID NO;

2410) or an active portion thereof;

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA (SEQ ID NO;

2411) or an active portion thereof;

or

UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO;

2412) or an active portion thereof.

2. A method of inducing a break in a target region of a double-stranded DNA molecule in a cell, the method comprising expressing in or introducing into the cell:

a Cas9 nuclease or nickase; and

a guide RNA that includes a complementarity region consisting of 17-18 nucleotides that are complementary to 17-18 consecutive nucleotides of the complementary strand of double-stranded DNA molecule.

3. A method of modifying a target region of a double-stranded DNA molecule in a cell, the method comprising expressing in or introducing into the cell:

a dCas9-heterologous functional domain fusion protein (dCas9-HFD); and

a guide RNA that includes a complementarity region consisting of 17-18 nucleotides that are complementary to 17-18 consecutive nucleotides of the complementary strand of a selected target genomic sequence.

21. The method of claim 3, wherein the dCas9-heterologous functional domain fusion protein (dCas9-HFD) comprises a HFD that modifies gene expression, histones, or DNA.

22. The method of claim 21, wherein the heterologous functional domain is a transcriptional activation domain, an enzyme that catalyzes DNA demethylation, an enzyme that catalyzes histone modification, or a transcription silencing domain.

23. The method of claim 22, wherein the transcriptional activation domain is from VP64 or NF-κ

B p65.

24. The method of claim 22, wherein the enzyme that catalyzes histone modification is LSD1, a histone methyltransferase (HNMT), histone acetyltransferase (HAT), histone deacetylase (HDAC), or histone demethylase.

25. The method of claim 22, wherein the transcription silencing domain is from Heterochromatin Protein 1 (HP1), e.g., HP1α

or HP1β

.

6. A guide RNA molecule having a target complementarity region of 17-18 nucleotides.

7. The gRNA of claim 6, wherein the target complementarity region consists of 17-18 nucleotides.

8. The gRNA of claim 6, wherein the target complementarity region consists of 17-18 nucleotides of target complementarity.

9. The gRNA of claim 6, consisting of the sequence:

15. A DNA molecule encoding the ribonucleic acid of claim 6.

16. A vector comprising the DNA molecule of claim 15.

17. A host cell expressing the vector of claim 16.