Increasing Specificity for RNA-Guided Genome Editing

• US 20160024524A1
• Filed: 03/14/2014
• Published: 01/28/2016
• Est. Priority Date: 03/15/2013
• Status: Active Grant

• Current Assignee: The General Hospital Corporation (Mass General Brigham, Inc.)
• Original Assignee: The General Hospital Corporation (Mass General Brigham, Inc.)
• Inventors: Joung, J. Keith, Sander, Jeffry D., Maeder, Morgan, Tsai, Shengdar, Angstman, James
• Granted Patent: US 9,885,033 B2
• Time in Patent Office: Days
• US Class Current: 1/1
• CPC Class Codes: C07K 14/005 from viruses
• CPC Class Codes: C07K 14/195 from bacteria
• CPC Class Codes: C07K 2319/00 Fusion polypeptide
• CPC Class Codes: C07K 2319/01 containing a localisation/targetting motif
• CPC Class Codes: C07K 2319/80 containing a DNA binding domain, e.g. Lacl or Tet-repressor
• CPC Class Codes: C12N 15/01 Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/1031 mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
• CPC Class Codes: C12N 15/11 DNA or RNA fragments; Modified forms thereof DNA or RNA not used in recombinant technology, C07H21/00; Non-coding nucleic acids having a biological activity
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/20 involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2710/00033 Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
• CPC Class Codes: C12N 2770/00033 Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
• CPC Class Codes: C12N 2800/80 Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/0071 acting on paired donors with incorporation of molecular oxygen (1.14)
• CPC Class Codes: C12N 9/1007 Methyltransferases (general) (2.1.1.)
• CPC Class Codes: C12N 9/16 acting on ester bonds (3.1)
• CPC Class Codes: C12N 9/22 Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12N 9/96 : Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
• CPC Class Codes: C12Y 114/11 : with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
• CPC Class Codes: C12Y 201/01 : Methyltransferases (2.1.1)
• CPC Class Codes: C12Y 301/00 : Hydrolases acting on ester bonds (3.1)
• CPC Class Codes: C12Y 301/21004 : Type II site-specific deoxyribonuclease (3.1.21.4)

Abstract

Methods for increasing specificity of RNA-guided genome editing, e.g., editing using CRISPR/Cas9 systems.

Claims

1. A synthetic guide ribonucleic acid, wherein:

one or more of the nucleotides is modified, e.g., locked (2′

-O-4′

-C methylene bridge), is 5′

-methylcytidine, is 2′

-O-methyl-pseudouridine, or in which the ribose phosphate backbone has been replaced by a polyamide chain; and

/or

wherein one or more of the nucleotides is a deoxyribonucleic acid.

2. The synthetic guide ribonucleic acid of claim 1, consisting of the sequence:

4. A DNA molecule encoding the ribonucleic acid of claim 1.

6. A host cell expressing the ribonucleic acid of claim 1.

30. A method of modifying a target region of a double-stranded DNA molecule, e.g., in a genomic sequence in a cell, the method comprising expressing in or introducing into the cell:

a dCas9-heterologous functional domain fusion protein (dCas9-HFD); and

(a) a guide RNA that includes one or more deoxyribonuclotides (e.g., where the sequence may also be partially or wholly DNA but with thymine in place or uracil) of claim 3;

or

(b) a guide RNA wherein one or more of the nucleotides is modified, e.g., locked (2′

-O-4′

-C methylene bridge), is 5′

-methylcytidine, is 2′

-O-methyl-pseudouridine, or in which the ribose phosphate backbone has been replaced by a polyamide chain e.g., a synthetic ribonucleic acid of claim 2.

32. The method of claim 30, wherein the dCas9-heterologous functional domain fusion protein (dCas9-HFD) comprises a HFD that modifies gene expression, histones, or DNA, e.g., transcriptional activation domain, transcriptional repressors (e.g., silencers such as Heterochromatin Protein 1 (HP1), e.g., HP1α

or HP1β

), enzymes that modify the methylation state of DNA (e.g., DNA methyltransferase (DNMT) or TET proteins, e.g., TET1), or enzymes that modify histone subunit (e.g., histone acetyltransferases (HAT), histone deacetylases (HDAC), or histone demethylases).

33. The method of claim 32, wherein the heterologous functional domain is a transcriptional activation domain, e.g., a transcriptional activation domain from VP64 or NF-κ

B p65;

an enzyme that catalyzes DNA demethylation, e.g., a TET;

or histone modification (e.g., LSD1, histone methyltransferase, HDACs, or HATs) or a transcription silencing domain, e.g., from Heterochromatin Protein 1 (HP1), e.g., HP1α

or HP1β

;

or a biological tether, e.g., MS2, Csy4 or lambda N protein.

3. A hybrid guide nucleic acid consisting of the sequence:

5. A vector comprising the DNA molecule of claim 3.

7. A method of inducing a single or double-stranded break in a target region of a double-stranded DNA molecule, e.g., in a target genomic sequence in a cell, the method comprising expressing in or introducing into the cell:

a Cas9 nuclease or nickase; and

(a) a guide RNA that includes one or more deoxyribonuclotides (e.g., where the sequence may also be partially or wholly DNA but with thymine in place or uracil) of claim 3;

or

(b) a guide RNA wherein one or more of the nucleotides is modified, e.g., locked (2′

-O-4′

-C methylene bridge), is 5′

-methylcytidine, is 2′

-O-methyl-pseudouridine, or in which the ribose phosphate backbone has been replaced by a polyamide chain.

8. A method of inducing a single or double-stranded break in a target region of a double-stranded DNA molecule, e.g., in a target genomic sequence in a cell, the method comprising expressing in or introducing into the cell:

a Cas9 nuclease or nickase;

a tracrRNA; and

(a) a crRNA that includes or more deoxyribonuclotides (e.g., wherein the sequence may also be partially or wholly DNA but with thymine in place or uracil), e.g., wherein the target complementarity region is at least partially or wholly DNA;

or

(b) a crRNA that includes one or more nucleotides that are modified, e.g., locked (2′

-O-4′

-C methylene bridge), is 5′

-methylcytidine, is 2′

-O-methyl-pseudouridine, or in which the ribose phosphate backbone has been replaced by a polyamide chain, e.g., wherein one or more of the nucleotides in the target complementarity region is modified.

9. A method of inducing sequence-specific paired nicks on opposing strands of a double-stranded DNA molecule, e.g., in a target genomic sequence in a cell, the method comprising expressing in the cell, or contacting the cell with, a Cas9-nickase, and:

(a) two guide RNAs, wherein one of the two guide RNAs includes sequence that is complementary to one strand of the target sequence and the second of the two guide RNAS includes sequence that is complementary to the other strand of the target sequence, such that using both guide RNAs results in targeting both strands, and the Cas9-nickase results in cuts being introduced into each strand;

or

(b) a tracrRNA and two crRNAs wherein one of the two crRNAs includes sequence that is complementary to one strand of the target sequence and the second of the two crRNAs is complementary to the other strand of the target sequence, such that using both crRNAs results in targeting both strands, and the Cas9-nickase cuts each strand.

10. The method of claim 9, comprising contacting the cell with two nickases, wherein the first nickase comprises a Cas9 with a mutation at D10, E762, H983, or D986 and the second nickase comprises a Cas9 with a mutation at H840 or N863.

11. A three-part fusion guide nucleic acid comprising, in any order that preserves activity of each part:

(1) a first sequence that is complementary to the complementary strand of a target genomic sequence;

(2) a second sequence comprising all or part of a Cas9 guide RNA that forms a stem-loop sequence that is recognized by and binds to Cas9; and

(3) a third sequence that is specifically bound by an RNA binding protein.

12. The three-part fusion guide nucleic acid of claim 11, wherein the RNA binding protein is MS2, CRISPR/Cas Subtype Ypest protein 4 (Csy4) or lambda N.

13. The three-part fusion guide nucleic acid of claim 11, wherein the first and second sequences comprise:

15. A DNA molecule encoding a three-part fusion guide nucleic acid of claim 11 or

a tracrRNA of claim 11 comprising a sequence of

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGTCGGUGCUUUU (SEQ ID NO:

15) or an active portion thereof,

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGC (SEQ ID NO;

16) or an active portion thereof;

or

AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC (SEQ ID NO;

17) or an active portion thereof, linked to a sequence that binds to an RNA binding protein, e.g., MS2, Csy4 (e.g., GUUCACUGCCGUAUAGGCAG or GUUCACUGCCGUAUAGGCAGCUAAGAAA), or lambda N.

27. A vector comprising the DNA molecule of claim 15.

29. A method of inducing a sequence-specific break in a double-stranded DNA molecule, e.g., in a target genomic sequence in a cell, the method comprising expressing in the cell, or contacting the cell with, a fusion protein comprising an RNA binding protein, e.g., MS2, Csy4, or lambda N, linked to a catalytic domain of a FokI nuclease, optionally with an intervening linker of 2-30, e.g., 5-20 nts,

a dCas9 protein, e.g., a FokI catalytic domain sequence fused to the N terminus of Csy4, with an intervening linker, e.g., a linker of from 2-30 amino acids, e.g., 10-24 amino acids;

and

(a) the three-part fusion guide nucleic acid of claim 11,

(b) a tracrRNA comprising a sequence of

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGTCGGUGCUUUU (SEQ ID NO;

15) or an active portion thereof,

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGC (SEQ ID NO;

16) or an active portion thereof;

or

AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC (SEQ ID NO;

17) or an active portion thereof, linked to a sequence that binds to an RNA binding protein, e.g., MS2, Csy4 (e.g., GUUCACUGCCGUAUAGGCAG or GUUCACUGCCGUAUAGGCAGCUAAGAAA), or lambda N, and a crRNA suitable for use with the tracrRNA;

or

(c) a DNA molecule encoding three-part fusion guide nucleic acid of 11 or a tracrRNA comprising a sequence of

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGTCGGUGCUUUU (SEQ ID NO;

15) or an active portion thereof,

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGC (SEQ ID NO;

16) or an active portion thereof;

or

AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC (SEQ ID NO;

17) or an active portion thereof, linked to a sequence that binds to an RNA binding protein, e.g., MS2, Csy4 (e.g., GUUCACUGCCGUAUAGGCAG or GUUCACUGCCGUAUAGGCAGCUAAGAAA), or lambda N.

14. A tracrRNA molecule comprising a sequence of

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGTCGGUGCUUUU (SEQ ID NO:

15) or an active portion thereof,

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGC (SEQ ID NO;

16) or an active portion thereof;

or

AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC (SEQ ID NO;

17) or an active portion thereof, linked to a sequence that binds to an RNA binding protein, e.g., MS2, Csy4 (e.g., GUUCACUGCCGUAUAGGCAG or GUUCACUGCCGUAUAGGCAGCUAAGAAA), or lambda N.

17. The fusion protein of claim 14, comprising a FokI catalytic domain sequence fused to the N terminus of Csy4, with an intervening linker, optionally a linker of from 2-30 amino acids, e.g., 4-12 amino acids, e.g., Gly₄Ser, (Gly₄Ser)_1-5.

28. A host cell expressing the vector of claim 17.

16. A fusion protein comprising:

(i) an RNA binding protein, optionally MS2, Csy4, or lambda N, linked to

(ii) a catalytic domain of a FokI nuclease or heterologous functional domain, optionally with an intervening linker of 2-30, e.g., 4-12 nts.

18. The fusion protein of claim 16, wherein the heterologous functional domain is a transcriptional silencer or transcriptional repression domain.

19. The fusion protein of claim 18, wherein the transcriptional repression domain is a Krueppel-associated box (KRAB) domain, ERF repressor domain (ERD), or mSin3A interaction domain (SID).

20. The fusion protein of claim 18, wherein the transcriptional silencer is Heterochromatin Protein 1 (HP1), e.g., HP1α

or HP1β

.

21. The fusion protein of claim 16, wherein the heterologous functional domain is an enzyme that modifies the methylation state of DNA.

22. The fusion protein of claim 21, wherein the enzyme that modifies the methylation state of DNA is a DNA methyltransferase (DNMT) or a TET protein.

23. The fusion protein of claim 22, wherein the TET protein is TET1.

24. The fusion protein of claim 16, wherein the heterologous functional domain is an enzyme that modifies a histone subunit.

25. The fusion protein of claim 24, wherein the enzyme that modifies a histone subunit is a histone acetyltransferase (HAT), histone deacetylase (HDAC), histone methyltransferase (HMT), or histone demethylase.

26. A DNA molecule encoding the fusion protein of claim 16.

31. A method of modifying a target region of a double-stranded DNA molecule, e.g., in a target genomic sequence in a cell, the method comprising expressing in or introducing into the cell:

a dCas9-heterologous functional domain fusion protein (dCas9-HFD);

a tracrRNA, and

(a) a crRNA that includes or more deoxyribonuclotides (e.g., wherein the sequence may also be partially or wholly DNA but with thymine in place or uracil), e.g., wherein the target complementarity region is at least partially or wholly DNA;

or

(b) a crRNA that includes one or more nucleotides that are modified, e.g., locked (2′

-O-4′

-C methylene bridge), is 5′

-methylcytidine, is 2′

-O-methyl-pseudouridine, or in which the ribose phosphate backbone has been replaced by a polyamide chain, e.g., wherein one or more of the nucleotides in the target complementarity region is modified.