POLYNUCLEOTIDE PROBE, METHOD FOR DETECTING A TARGET NUCLEIC ACID BY USING THE SAME AND KIT COMPRISING THE SAME

• US 20160130653A1
• Filed: 11/11/2014
• Published: 05/12/2016
• Est. Priority Date: 11/11/2014
• Status: Active Grant

• Current Assignee: National Taiwan University (Government of The Republic of China)
• Original Assignee: National Taiwan University (Government of The Republic of China)
• Inventors: Ho, Ja-An A., Jou, Amily F., Ou, Yen-Chuan, Wang, Shian-Shiang, Willner, Itamar, Hsu, Shih-Lan
• Granted Patent: US 9,902,997 B2
• Time in Patent Office: Days
• US Class Current: 1/1
• CPC Class Codes: C12Q 1/6816 characterised by the detection means C12Q1/6804 takes precedence
• CPC Class Codes: C12Q 1/6886 for cancer immunoassay for cancer G01N33/574
• CPC Class Codes: C12Q 2521/113 Telomerase
• CPC Class Codes: C12Q 2525/155 incorporating/generating a new priming site
• CPC Class Codes: C12Q 2565/501 being an array of oligonucleotides
• CPC Class Codes: C12Q 2600/178 miRNA, siRNA or ncRNA

Abstract

The present invention provides a method for detecting a target nucleic acid that comprises a step of providing a sample; contacting the sample with a polynucleotide probe comprising a first sequence and a second sequence complementary to the target nucleic acid; and adding a nuclease for cleaving the second sequence of the polynucleotide probe. The present invention further provides a polynucleotide probe for detecting a target nucleic acid that comprises a first sequence and a second sequence complementary to the target nucleic acid. Moreover, the present invention provides a kit for detecting a target nucleic acid.

Claims

1. A polynucleotide probe for detecting a target nucleic acid, comprising:

a first sequence; and

a second sequence complementary to the target nucleic acid.

2. The polynucleotide probe according to claim 1, wherein the first sequence comprises a telomerase primer.

3. The polynucleotide probe according to claim 2, wherein the telomerase primer is at least three continuous nucleotides complementary to a sequence represented by any one of SEQ ID NOs. 1-5.

4. The polynucleotide probe according to claim 2, the telomerase primer is at least three continuous nucleotides selected from TTAGGG (SEQ ID NO. 6).

5. The polynucleotide probe according to claim 1, wherein the second sequence is CCATCTTTACCAGACAGTGTTA (SEQ ID NO. 20).

6. The polynucleotide probe according to claim 1, wherein the polynucleotide probe is further connected to a support.

7. The polynucleotide probe according to claim 6, wherein the support is a nanoparticle or a bead.

8. The polynucleotide probe according to claim 7, wherein the nanoparticle comprises one selected from the group consisting of core-type quantum dot, a core-shell quantum dot, an alloyed quantum dot and a combination thereof.

9. The polynucleotide probe according to claim 8, wherein the nanoparticle is a CdSe/ZnS quantum dot.

10. The polynucleotide probe according to claim 1, wherein the polynucleotide probe is further connected to an acceptor.

11. The polynucleotide probe according to claim 10, wherein the acceptor is BHQ2 or Cy5.

13. The method according to claim 1, wherein the nuclease is a duplex-specific nuclease.

21. A kit for detecting a target nucleic acid, comprising:

the polynucleotide probe according to claim 1; and

a nuclease.

22. The kit according to claim 21, wherein the nuclease is a duplex-specific nuclease.

23. The kit according to claim 21, further comprising a nucleic acid synthesis enzyme.

24. The kit according to claim 23, wherein the nucleic acid synthesis enzyme is telomerase.

25. The kit according to claim 21, further comprising an optical active molecule or hemin.

26. The kit according to claim 21, further comprising a reagent that contains luminal and H₂O₂ or contains ABTS and H₂O₂.

12. A method for detecting a target nucleic acid, comprising:

providing a sample;

contacting the sample with the polynucleotide probe according to claim; and

adding a nuclease for cleaving the second sequence of the polynucleotide probe.

14. The method according to claim 12, further comprising adding a nucleic acid synthesis enzyme for providing an extension product.

15. The method according to claim 14, wherein the nucleic acid synthesis enzyme is telomerase.

16. The method according to claim 14, wherein the extension product comprises a nucleotide sequence represented by any one of SEQ ID NOs. 6-19.

17. The method according to claim 14, further comprising adding a compound for forming a complex with the extension product.

18. The method according to claim 17, wherein the compound is an optical active molecule or hemin.

19. The method of according to claim 17, wherein the complex is an optical active molecule-labeled G-quadruplex or a telomeric hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme.

20. The method according to claim 17, further comprising detecting a signal generated from the complex.