sirna/Nanoparticle Formulations for Treatment of Middle-East Respiratory Syndrome Coronaviral Infection

• US 20190030187A1
• Filed: 09/07/2016
• Published: 01/31/2019
• Est. Priority Date: 09/08/2015
• Status: Active Grant

• Current Assignee: Sirnaomics, Inc.
• Original Assignee: Sirnaomics, Inc.
• Inventors: Lu, Patrick Y., Simonenko, Vera, Cai, Yibin, Xu, John, Evans, David
• Granted Patent: US 11,058,779 B2
• Time in Patent Office: Days
• CPC Class Codes: A61K 47/28 Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
• CPC Class Codes: A61K 47/543 Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
• CPC Class Codes: A61K 48/0008 characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
• CPC Class Codes: A61K 48/0066 Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
• CPC Class Codes: A61K 9/127 Liposomes
• CPC Class Codes: A61K 9/5153 Polyesters, e.g. poly(lactide-co-glycolide)
• CPC Class Codes: A61P 31/14 for RNA viruses
• CPC Class Codes: B82Y 5/00 Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
• CPC Class Codes: C12N 15/1131 against viruses
• CPC Class Codes: C12N 15/88 using microencapsulation, e.g. using amphiphile liposome vesicle
• CPC Class Codes: C12N 2310/14 interfering N.A.
• CPC Class Codes: C12N 2320/31 Combination therapy
• CPC Class Codes: C12N 2320/32 Special delivery means, e.g. tissue-specific

Abstract

The present invention relates to compositions and methods for siRNA therapeutics for prevention and treatment of Middle East Respiratory Syndrome Corona Virus (MERS-CoV) infections. The compositions include a pharmaceutical composition comprising siRNA cocktails that target viral genes and pharmaceutically acceptable polymeric nanoparticle carriers and liposomal nanoparticle carriers.

Claims

1. A pharmaceutical composition comprising at least two different siRNA molecules that target one or more conserved regions of the genome of a Middle-East Respiratory Syndrome Corona Virus (MERS-CoV) and a pharmaceutically acceptable carrier comprising a polymeric nanoparticle or a liposomal nanoparticle.

2. The composition of claim 1, wherein the gene sequences in the conserved regions of the MERS-CoV are critical for the viral infection of a mammal.

4. The composition of claim 1, wherein the targeted conserved regions of the genome comprise gene sequences coding for MERS-CoV proteins selected from the group consisting of Papain-like protease (PL^pro), RNA-dependent RNA polymerase (RdRp), and Spike protein.

5. The composition of claim 4, wherein the siRNA molecules target PL^pro viral gene expression.

6. The composition of claim 4, wherein the siRNA molecules target RdRp viral gene expression.

7. The composition of claim 4, wherein the siRNA molecules target Spike viral gene expression.

8. The composition of claim 4, wherein the siRNA molecules are selected from the group consisting of:

9. The composition of claim 5, wherein the siRNA molecules that target the PL^pro gene are selected from the group consisting of:

10. The composition of claim 6, wherein the siRNA molecules that target the RdRp gene are selected from the group consisting of:

11. The composition of claim 7, wherein the siRNA molecules that target the Spike gene are selected from the group consisting of:

12. The composition of claim 1, comprising a siRNA cocktail, MST^PR1, wherein a first siRNA molecule comprises MPL1:

CGCAAUACGUAAAGCUAAAGAUUAU (SEQ ID NO;

     1057) and a second siRNA molecule comprises MRR1;

CCCAGUGUUAUUGGUGUUUAUCAUA (SEQ ID NO;

     7).

13. The composition of claim 1, comprising a siRNA cocktail, MST^PR2, wherein a first siRNA molecule comprises MPL2:

GGGGUUGAUUAUACUAAGAAGUUU (SEQ ID NO;

     1058) and a second siRNA molecule comprises MRR2;

GGGAUUUCAUGCUUAAAACAUUGUA (SEQ ID NO;

     8).

14. The composition of claim 1, comprising a siRNA cocktail, MST^RS2, wherein a first siRNA molecule comprises MRR2:

GGGAUUUCAUGCUUAAAACAUUGUA (SEQ ID NO;

     20) and a second siRNA molecule comprises MSP2;

GGCCGUACAUAUUCUAACAUAACUA (SEQ ID NO;

     12).

15. The composition of claim 1, comprising a siRNA cocktail, MST^RS1, wherein a first siRNA molecule comprises MRR1:

CCCAGUGUUAUUGGUGUUUAUCAUA (SEQ ID NO;

     21) and a second siRNA molecule comprises MSP1;

GGCCGUACAUAUUCUAACAUAACUA (SEQ ID NO;

     12).

16. The composition of claim 1, comprising a siRNA cocktail, MST^PRS1, wherein a first siRNA molecule comprises MPL1:

CGCAAUACGUAAAGCUAAAGAUAU (SEQ ID NO;

     22), a second siRNA molecule comprises MRR1;

CCCAGUGUUAUUGGUGUUUAUCAUA (SEQ ID NO;

     7), and a third siRNA molecule comprises MSP1;

GGCCGUACAUAUUCUAACAUAACUA (SEQ ID NO;

     12)

17. The composition of claim 1, comprising a siRNA cocktail, MST^PRS2, wherein a first siRNA molecule comprises MPL2:

GGGUGUUGAUUAUACUAAGAAGUUU (SEQ ID NO;

     1059) a second siRNA molecule comprises MRR2;

GGGAUUUCAUGCUUAAAACAUUGUA (SEQ ID NO;

     8), and a third siRNA molecule comprises MSP2;

GGCCGUACAUAUUCUAACAUAACUA (SEQ ID NO;

     12).

18. The composition of claim 1, wherein the polymeric nanoparticle carrier comprises a Histidine-Lysine co-polymer (HKP).

20. The composition of claim 1, wherein the liposomal nanoparticle carrier comprises a Spermine-Lipid Conjugate (SLiC) and cholesterol.

29. A method of treating a mammal with a MERS infection comprising administering to said mammal a pharmaceutically effective amount of the composition of claim 1.

37. The method of claim 29, wherein the mammal is a human.

3. (canceled)

19. (canceled)

21-28. -28. (canceled)

30-36. -36. (canceled)

38. An siRNA molecule that targets a conserved region of the genome of a MERS-CoV.

39. The siRNA molecule of claim 38, wherein the targeted conserved region of the genome comprises gene sequences coding for MERS-CoV proteins selected from the group consisting of Papain-like protease (PL^pro), RNA-dependent RNA polymerase (RdRp), and Spike protein.

40. The siRNA molecule of claim 39, wherein the siRNA molecule targets PL^pro virus gene expression.

41. The siRNA molecule of claim 39, wherein the siRNA molecule targets RdRp viral gene expression.

42. The siRNA molecule of claim 39, wherein the siRNA molecule targets Spike viral gene expression.

43. The siRNA molecule of claim 38, wherein the molecule is selected from the group consisting of the molecules identified in Table 3.

44. The siRNA molecule of claim 38, wherein the wherein the siRNA molecules are selected from the group consisting of:

48. A composition comprising the siRNA molecule of claim 38 and a pharmaceutically acceptable carrier comprising a polymeric nanoparticle or a liposomal nanoparticle.

49. A method of treating a mammal with a MERS infection comprising administering to said mammal a pharmaceutically effective amount of the composition of claim 48.

50. The method of claim 49, wherein the mammal is a human.

51. The composition of claim 44, wherein the siRNA molecules comprise derivatives of the identified siRNA molecules, the derivatives having 17-24 contiguous base pairs of original 25 contiguous base pairs of the identified molecules or one or more base pairs in addition to the original 25 contiguous base pairs of the identified molecules.

45-47. -47. (canceled)