METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION

• US 20190169643A1
• Filed: 02/14/2019
• Published: 06/06/2019
• Est. Priority Date: 05/25/2012
• Status: Active Grant

• Current Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Original Assignee: The University Of Vienna, Regents of the University of California (University of California)
• Inventors: Doudna, Jennifer A., Jinek, Martin, Chylinski, Krzysztof, Charpentier, Emmanuelle
• Granted Patent: US 10,640,791 B2
• Time in Patent Office: Days
• CPC Class Codes: A01H 6/4684 Zea mays [maize]
• CPC Class Codes: A01K 67/027 New or modified breeds of vertebrates
• CPC Class Codes: A61K 38/465 acting on ester bonds (3.1), e.g. lipases, ribonucleases
• CPC Class Codes: A61K 48/00 Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• CPC Class Codes: A61P 31/00 Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• CPC Class Codes: A61P 31/04 Antibacterial agents
• CPC Class Codes: A61P 31/12 Antivirals
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/111 General methods applicable to biologically active non-coding nucleic acids
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/746 for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/902 using homologous recombination
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/11 Antisense
• CPC Class Codes: C12N 2310/13 Decoys
• CPC Class Codes: C12N 2310/14 : interfering N.A.
• CPC Class Codes: C12N 2310/20 : involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2310/31 : of the backbone
• CPC Class Codes: C12N 2310/32 : of the sugar
• CPC Class Codes: C12N 2310/33 : of the base
• CPC Class Codes: C12N 2310/3519 : Fusion with another nucleic acid
• CPC Class Codes: C12N 2310/531 : Stem-loop; Hairpin
• CPC Class Codes: C12N 2800/80 : Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 9/22 : Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Q 1/686 : Polymerase chain reaction [PCR]
• CPC Class Codes: C12Y 301/04 : Phosphoric diester hydrolases (3.1.4)
• CPC Class Codes: H01L 21/02312 : treatment by exposure to a gas or vapour
• CPC Class Codes: H01L 21/02365 : Forming inorganic semiconducting materials on a substrate for light-sensitive devices H01L31/00
• CPC Class Codes: H01L 33/0075 : comprising nitride compounds
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

1. A single-molecule DNA-targeting RNA having the structure:

2. A method of cleaving a target DNA, the method comprising:

contacting a target DNA with a complex comprising;

(a) the single molecule DNA-targeting RNA of claim 1; and

(b) a Cas9 protein comprising the S. pyogenes Cas9 amino acid sequence set forth as SEQ ID NO.;

2,

wherein prior to said contacting the target DNA is double stranded and comprises a nucleotide sequence taatgaattccccaatacecaaaagcgcaagaagaaatcaaccagcgca (SEQ ID NO;

     302) hybridized to a nucleotide sequence tgcgctggttgatttcttettgcgctttttgggtattggggaattcatta (SEQ ID NO;

     301),

wherein said contacting is in vitro and does not take place inside of a cell, and

wherein the method results in cleavage of the target DNA.