RNA-Guided Human Genome Engineering

• US 20200048656A1
• Filed: 06/13/2019
• Published: 02/13/2020
• Est. Priority Date: 12/17/2012
• Status: Active Grant

• Current Assignee: President and Fellows of Harvard College (Harvard Corporation)
• Original Assignee: President and Fellows of Harvard College (Harvard Corporation)
• Inventors: Church, George M., Mali, Prashant G., Yang, Luhan
• Granted Patent: US 11,535,863 B2
• Time in Patent Office: Days
• CPC Class Codes: C12N 15/01 Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
• CPC Class Codes: C12N 15/10 Processes for the isolation, preparation or purification of DNA or RNA chemical preparation of DNA or RNA C07H21/00; preparation of non-structural polynucleotides from microorganisms or with enzymes C12P19/34
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 15/1024 In vivo mutagenesis using high mutation rate "mutator" host strains by inserting genetic material, e.g. encoding an error prone polymerase, disrupting a gene for mismatch repair
• CPC Class Codes: C12N 15/63 Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• CPC Class Codes: C12N 15/81 for yeasts
• CPC Class Codes: C12N 15/8201 Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 15/87 Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
• CPC Class Codes: C12N 15/90 Stable introduction of foreign DNA into chromosome
• CPC Class Codes: C12N 15/907 in mammalian cells
• CPC Class Codes: C12N 2310/20 involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• CPC Class Codes: C12N 2800/80 Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• CPC Class Codes: C12N 2810/55 from bacteria
• CPC Class Codes: C12N 9/22 Ribonucleases RNAses, DNAses catalytic nucleic acids C12N15/113
• CPC Class Codes: C12Y 301/00 Hydrolases acting on ester bonds (3.1)

Abstract

A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

Claims

1. A method of altering a eukaryotic cell comprising

transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell,

transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner,

wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

2. The method of claim 1 wherein the enzyme is Cas9.

3. The method of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.

4. The method of claim 1 wherein the RNA includes between about 10 to about 250 nucleotides.

5. The method of claim 1 wherein the RNA includes between about 20 to about 100 nucleotides.

6. The method of claim 1 wherein the eukaryotic cell is a human cell.

10. The method of claim 1 wherein the eukaryotic cell is transfected with

a plurality of nucleic acids encoding RNAs complementary to different sites on genomic DNA of the eukaryotic cell,

wherein the cell expresses the RNAs and the enzyme, the RNAs bind to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

16. The method of claim 1, wherein said modification of the target DNA molecule is cleavage of the target DNA molecule.

17. The method of claim 1, wherein the target sequence is 15 nucleotides (nt) to 18 nt long.

18. The method of claim 1, wherein the target sequence is 18 nucleotides (nt) to 24 nt long.

19. The method of claim 1, wherein the target DNA molecule is chromosomal DNA.

7-9. -9. (canceled)

11-14. -14. (canceled)

15. A method of modifying a target DNA molecule, the method comprising:

contacting a target DNA molecule having a target sequence with a complex comprising;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA that hybridizes with the target sequence, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,

wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 11 base pairs,

wherein said contacting takes place outside of a bacterial cell and outside of an archaeal cell, thereby resulting in modification of the target DNA molecule.

20. A method of modifying a target DNA molecule, the method comprising:

transfecting a cell comprising a target DNA molecule having a target sequence with nucleic acids to form a complex comprising;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA that hybridizes with the target sequence, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,

wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 11 base pairs,

wherein said transfecting takes place outside of a bacterial cell and outside of an archaeal cell, thereby resulting in modification of the target DNA molecule.

21. The method of claim 20, wherein said modification of the target DNA molecule is cleavage of the target DNA molecule.

22. The method of claim 20, wherein the target sequence is 16 nucleotides (nt) to 24 nt long.

23. The method of claim 20, wherein the target sequence is 18 nucleotides (nt) to 24 nt long.

24. The method of claim 21, wherein the target DNA molecule is chromosomal DNA.

25. A nucleic acid molecule encoding a single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises:

(a) a DNA-targeting segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule, and

(b) a protein-binding segment comprising two complementary stretches of nucleotides that hybridize to form a double stranded RNA (dsRNA) duplex, wherein said two complementary stretches of nucleotides are covalently linked to one another with intervening nucleotides,

wherein the DNA-targeting segment is positioned 5′

of both of said two complementary stretches of nucleotides, and wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and targeting the complex to the target sequence of the target DNA molecule.

26. The nucleic acid molecule of claim 25, wherein the nucleic acid molecule is a recombinant expression vector.

27. The nucleic acid molecule of claim 25, wherein the nucleic acid molecule is a vector selected from the group consisting of plasmids, and viral vectors.

32. The nucleic acid molecule of claim 25 wherein the target sequence is in a eukaryotic DNA molecule.

33. The nucleic acid molecule of claim 25 wherein the target sequence is in a human DNA molecule.

34. The nucleic acid molecule of claim 25 wherein the single molecule DNA-targeting RNA is between about 100 to about 250 nucleotides.

35. The nucleic acid molecule of claim 25 wherein the single molecule DNA-targeting RNA comprises

28. A composition comprising:

(1) a single molecule DNA-targeting RNA, or a nucleic acid encoding said single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises;

(a) a DNA-targeting segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule, and

(b) a protein-binding segment comprising two complementary stretches of nucleotides that hybridize to form a double stranded RNA (dsRNA) duplex, wherein said two complementary stretches of nucleotides are covalently linked to one another with intervening nucleotides,

wherein the DNA-targeting segment is positioned 5′

of both of said two complementary stretches of nucleotides, and wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and targeting the complex to the target sequence of the target DNA molecule; and

(2) one or more of;

(i) a nuclease inhibitor, (ii) a buffering agent, and (iii) a pharmaceutically-acceptable, non-toxic carrier or diluent.

29. The composition of claim 28, further comprising one or more of:

a polyamine and a lipid.

36. The composition of claim 28 wherein the target sequence is in a eukaryotic DNA molecule.

37. The composition of claim 28 wherein the target sequence is in a human DNA molecule.

38. The composition of claim 28 wherein the single molecule DNA-targeting RNA is between about 100 to about 250 nucleotides.

39. The composition of claim 28 wherein the single molecule DNA-targeting RNA comprises

30. A single molecule DNA-targeting RNA, or a nucleic acid comprising a

nucleotide sequence encoding said single molecule DNA-targeting RNA,

wherein the single molecule DNA-targeting RNA comprises:

i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule, and

ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded duplex of a protein-binding segment, p1 wherein i) and ii) are arranged in a 5′

to 3′

orientation and are covalently linked to one another with intervening nucleotides; and

wherein the single molecule DNA-targeting RNA forms a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence targets the Cas9 protein to the target DNA molecule.

40. The single molecule DNA-targeting RNA, or a nucleic acid comprising a

nucleotide sequence encoding said single molecule DNA-targeting RNA of claim 30 wherein the target sequence is in a eukaryotic DNA molecule.

41. The single molecule DNA-targeting RNA, or a nucleic acid comprising a

nucleotide sequence encoding said single molecule DNA-targeting RNA of claim 30 wherein the target sequence is in a human DNA molecule.

42. The single molecule DNA-targeting RNA, or a nucleic acid comprising a

nucleotide sequence encoding said single molecule DNA-targeting RNA of claim 30 wherein the single molecule DNA-targeting RNA is between about 100 to about 250 nucleotides.

43. The single molecule DNA-targeting RNA, or a nucleic acid comprising a

nucleotide sequence encoding said single molecule DNA-targeting RNA of claim 30 wherein the single molecule DNA-targeting RNA comprises

44. The single molecule DNA-targeting RNA, or a nucleic acid comprising a

nucleotide sequence encoding said single molecule DNA-targeting RNA of claim 30 wherein the target sequence is in a eukaryotic DNA molecule.

31. A single molecule DNA-targeting RNA comprising:

i) a targeter RNA that hybridizes with a target sequence in a DNA molecule; and

ii) an activator RNA that hybridizes with the targeter RNA to form a double-stranded duplex of a protein binding segment,

wherein i) and ii) are arranged in a 5′

to 3′

orientation and are covalently linked to one another with intervening nucleotides, and

wherein the single molecule DNA-targeting RNA forms a complex with a Cas9 protein and the targeter RNA hybridizes to the target sequence to direct the complex to the target sequence.

45. The single molecule DNA-targeting RNA of claim 31 wherein the target sequence is in a human DNA molecule.

46. The single molecule DNA-targeting RNA of claim 31 wherein the single molecule DNA-targeting RNA is between about 100 to about 250 nucleotides.

47. The single molecule DNA-targeting RNA of claim 31 wherein the single molecule DNA-targeting RNA comprises

48. A method of cleaving or editing a target DNA molecule or modulating transcription of at least one gene encoded thereon, the method comprising:

contacting a target DNA molecule having a target sequence with an engineered and/or nonnaturally-occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising;

a) a single molecule DNA-targeting RNA comprising

i) a targeter-RNA that hybridizes with the target sequence, and

ii) an activator-RNA that hybridizes with the targeter-RNA to form a double stranded RNA duplex of a protein-binding segment, wherein the targeter-RNA and the activator-RNA are covalently linked to one another with intervening nucleotides; and

b) a Cas9 protein,

wherein the single molecule DNA-targeting RNA forms a complex with the Cas9 protein, thereby targeting the Cas9 protein to the target DNA molecule, whereby said target DNA molecule is cleaved or edited or transcription of at least one gene encoded by the target DNA molecule is modulated, and wherein said contacting occurs in a eukaryotic cell.

49. The method of claim 48, wherein, prior to the contacting step, the method comprises:

introducing into the eukaryotic cell containing the target DNA molecule;

1) the single molecule DNA-targeting RNA, or a DNA molecule comprising a nucleotide sequence that (i) encodes the single molecule DNA-targeting RNA and (ii) is operably linked to a regulatory element operable in said eukaryotic cell; and

2) the Cas9 protein, an RNA molecule comprising a nucleotide sequence encoding the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that

(i) encodes the Cas9 protein and

(ii) is operably linked to a regulatory element operable in said eukaryotic cell.

50. The method of claim 49, wherein the eukaryotic cell'"'"'s genome comprises the target DNA molecule.

51. The method of claim 49, wherein the eukaryotic cell is a mammalian cell or a human cell.

52. The method of claim 49, wherein the DNA molecule comprising the nucleotide sequence that encodes the single molecule DNA-targeting RNA is a vector selected from the group consisting of viral and adeno associated virus vectors.

53. The method of claim 49, wherein the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein is a plasmid vector.

54. The method of claim 49, wherein the CRISPR-Cas system comprises two or more single molecule DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding single molecule DNA-targeting RNAs.

55. The method of claim 49, wherein the method comprises creation of a double strand break in the target DNA molecule which is repaired by a non-homologous end joining (NHEJ) repair mechanism, thereby editing the target DNA molecule.

56. The method of claim 49, wherein the method comprises creation of a double strand break in the target DNA molecule which is repaired by a homology-directed repair mechanism which incorporates a sequence of a donor polynucleotide into the target DNA molecule, thereby editing the target DNA molecule.

57. The method of claim 49, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

58. The method of claim 49, wherein the method comprises editing the target DNA molecule by insertion of a sequence of a donor polynucleotide into the cleaved strand of the target DNA molecule.

59. The method of claim 49, wherein said Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or a HNH domain.

60. The method of claim 59, wherein the DNA molecule comprising the nucleotide sequence that encodes the single molecule DNA-targeting RNA is a vector selected from the group consisting of viral and adeno associated virus vectors.

61. The method of claim 59, wherein the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein is a plasmid vector.

62. The method of claim 59, wherein the CRISPR-Cas system comprises two or more single molecule DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding single molecule DNA-targeting RNAs.

63. The method of claim 59, wherein the method comprises editing the target DNA molecule by insertion of a sequence of a donor polynucleotide into the cleaved strand of the target DNA molecule.

64. The method of claim 59, wherein the method comprises editing the target DNA molecule by a homology-directed repair mechanism.

65. The method of claim 49, wherein the eukaryotic cell is an in vivo plant cell or in vivo animal cell, and wherein the method comprises introducing into the in vivo plant cell or in vivo animal cell:

(1) the single molecule DNA-targeting RNA, or a DNA molecule comprising a nucleotide sequence that

(i) encodes the single molecule DNA-targeting RNA and

(ii) is operably linked to a regulatory element operable in said eukaryotic cell; and

(2) the Cas9 protein, an RNA molecule comprising a nucleotide sequence encoding the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is operably linked to a regulatory element operable in said eukaryotic cell,

wherein the method results in editing of the target DNA.

66. The method of claim 65, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

67. The method of claim 65, wherein the DNA molecule comprising the nucleotide sequence that encodes the single molecule DNA-targeting RNA, and/or the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein is a vector selected from the group consisting of plasmids and viral vectors.

68. The method of claim 65, wherein the method comprises introducing into the eukaryotic cell two or more single molecule DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding single molecule DNA-targeting RNAs.

69. A method of cleaving or editing a target DNA molecule or modulating transcription of a gene encoded by the target DNA molecule, the method comprising

introducing a Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising

(1) a single molecule DNA-targeting RNA, or a nucleic acid comprising a nucleotide sequence encoding said single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises:

i) a targeter-RNA that is capable of hybridizing with a target sequence in the target DNA molecule,

and

ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex of a protein-binding segment,

wherein i) and ii) are arranged in a 5′

to 3′

orientation and are covalently linked to one another with intervening nucleotides;

wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA molecule, and

(2) the Cas9 protein, or a nucleic acid comprising a nucleotide sequence encoding the Cas9 protein,

into a eukaryotic cell containing the target DNA molecule having the target sequence.

70. A method of cleaving or editing a target DNA molecule or modulating transcription of at least one gene encoded thereon, the method comprising

contacting a target DNA molecule having a target sequence with an engineered and/or nonnaturally-occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising:

(a) a Cas9 protein; and

b) a DNA-targeting RNA comprising;

(i) a targeter-RNA that hybridizes with the target sequence, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment,

wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9,

wherein said contacting takes place outside of a bacterial cell and outside an archaeal cell,

wherein the DNA-targeting RNA forms a complex with the Cas9 protein, whereby said target DNA molecule is cleaved or edited or transcription of at least one gene encoded by the target DNA molecule is modulated,

wherein said contacting occurs in a eukaryotic cell.

71. The method of claim 70, wherein, prior to the contacting step, the method comprises:

introducing into the eukaryotic cell containing the target DNA molecule;

1) the DNA-targeting RNA, or one or more DNA molecules comprising one or more nucleotide sequences that (i) encode the DNA-targeting RNA and (ii) are operably linked to regulatory elements operable in said eukaryotic cell; and

2) the Cas9 protein, an RNA molecule comprising a nucleotide sequence encoding the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is operably linked to a regulatory element operable in said eukaryotic cell.

74. The method of claim 71, wherein one or more DNA molecules are one or more vectors that are selected from the group consisting of viral vectors and adeno-associated virus vectors.

75. The method of claim 71, wherein the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein is a plasmid vector.

76. The method of claim 71, wherein the CRISPR-Cas system comprises two or more different DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

77. The method of claim 71, wherein the method comprises creation of a double strand break in the target DNA molecule which is repaired by a non-homologous end joining (NHEJ) repair mechanism, thereby editing the target DNA molecule.

78. The method of claim 71, wherein the method comprises creation of a double strand break in the target DNA molecule which is repaired by a homology-directed repair mechanism which incorporates a sequence of a donor polynucleotide into the target DNA molecule, thereby editing the target DNA molecule.

79. The method of claim 71, wherein the Cas9 protein comprises an amino acid sequence that is modified, relative to naturally occurring Cas9, to include one or more mutations in a RuvC domain and/or a HNH domain.

80. The method of claim 71, wherein the method comprises editing the target DNA molecule by insertion of a sequence of a donor polynucleotide into the cleaved strand of the target DNA molecule.

81. The method of claim 71, wherein said Cas9 protein cleaves only one strand of DNA and comprises an amino acid sequence that is modified, relative to naturally occurring Cas9, to include one or more mutations in a RuvC domain and/or a HNH domain.

82. The method of claim 81, wherein the one or more DNA molecules are one or more vectors that are selected from the group consisting of viral vectors and adeno-associated virus vectors.

83. The method of claim 81, wherein the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein is a plasmid vector.

84. The method of claim 81, wherein the CRISPR-Cas system comprises two or more different DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

85. The method of claim 81, wherein the method comprises editing the target DNA molecule by insertion of a sequence of a donor polynucleotide into the cleaved strand of the target DNA molecule.

86. The method of claim 81, wherein the method comprises editing the target DNA molecule by a homology-directed repair mechanism.

87. The method of claim 71, wherein the eukaryotic cell is an in vivo plant cell or in vivo animal cell, and wherein the method comprises introducing into the in vivo plant cell or in vivo animal cell:

(1) the DNA-targeting RNA, or one or more DNA molecules comprising nucleotide sequences that (i) encode the DNA-targeting RNA and (ii) are operably linked to a regulatory element operable in said eukaryotic cell; and

(2) the Cas9 protein, an RNA molecule comprising a nucleotide sequence encoding the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is operably linked to a regulatory element operable in said eukaryotic cell, wherein the method results in editing of the target DNA.

88. The method of claim 87, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

89. The method of claim 87, wherein:

the one or more DNA molecules comprising the nucleotide sequences that encode the DNA-targeting RNA, and/or the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein, are vectors selected from the group consisting of plasmids and viral vectors.

90. The method of claim 87, wherein said CRISPR-Cas system comprises two or more DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding DNA-targeting RNAs.

72. The method of 71, wherein the eukaryotic cell'"'"'s genome comprises the target DNA molecule.

73. The method of 71, wherein the eukaryotic cell is a mammalian cell or a human cell.

91. A method of cleaving or editing a target DNA molecule or modulating transcription of at least one gene encoded thereon, the method comprising contacting a target DNA molecule having a target sequence with an engineered and/or non-naturally-occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising:

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA that hybridizes with the target sequence, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment,

wherein said contacting takes place outside of a bacterial cell and outside an archaeal cell,

wherein the DNA-targeting RNA forms a complex with the Cas9 protein, whereby said target DNA molecule is cleaved or edited or transcription of at least one gene encoded by the target DNA molecule is modulated.

92. The method of claim 91, wherein, prior to the contacting step, the method comprises:

introducing into the eukaryotic cell containing the target DNA molecule;

1) the DNA-targeting RNA, or one or more DNA molecules comprising one or more nucleotide sequences that (i) encode the DNA-targeting RNA and (ii) are operably linked to regulatory elements operable in said eukaryotic cell; and

2) the Cas9 protein, an RNA molecule comprising a nucleotide sequence encoding the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is operably linked to a regulatory element operable in said eukaryotic cell.

93. The method of claim 92, wherein the eukaryotic cell'"'"'s genome comprises the target DNA molecule.

94. The method of claim 92, wherein the eukaryotic cell is a mammalian cell or a human cell.

95. The method claim 92, wherein the one or more DNA molecules are one or more vectors that are selected from the group consisting of viral and adeno-associated virus vectors.

96. The method of claim 92, wherein the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein is a plasmid vector.

97. The method of claim 92, wherein the CRISPR-Cas system comprises two or more different DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

98. The method of claim 92, wherein the method comprises creation of a double strand break in the target DNA molecule which is repaired by a non-homologous end joining (N HEJ) repair mechanism, thereby editing the target DNA molecule.

99. The method of claim 92, wherein the method comprises creation of a double strand break in the target DNA molecule which is repaired by a homology-directed repair mechanism which incorporates a sequence of a donor polynucleotide into the target DNA molecule, thereby editing the target DNA molecule.

100. The method of claim 92, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

101. The method of claim 92, wherein the method comprises editing the target DNA molecule by insertion of a sequence of a donor polynucleotide into the cleaved strand of the target DNA molecule.

102. The method of claim 92, wherein said Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or a HNH domain.

103. The method of claim 102, wherein the one or more DNA molecules are one or more vectors that are selected from the group consisting of viral and adeno-associated virus vectors.

104. The method of claim 102, wherein the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein is a plasmid vector.

105. The method of claim 102, wherein the CRISPR-Cas system comprises two or more different DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

106. The method of claim 102, wherein the method comprises editing the target DNA molecule by insertion of a sequence of a donor polynucleotide into the cleaved strand of the target DNA molecule.

107. The method of claim 102, wherein the method comprises editing the target DNA molecule by a homology-directed repair mechanism.

108. The method of claim 92, wherein the eukaryotic cell is an in vivo plant cell or in vivo animal cell and wherein the method comprises introducing into the in vivo plant cell or in vivo animal cell:

1) the DNA targeting RNA, or one or more DNA molecules comprising nucleotide sequences that (i) encode the DNA-targeting RNA and (ii) are operably linked to a regulatory element operable in said eukaryotic cell; and

(2) the Cas9 protein, an RNA molecule comprising a nucleotide sequence encoding the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is operably linked to a regulatory element operable in said eukaryotic cell,

wherein the method results in editing of the target DNA.

109. The method of claim 108, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

110. The method of claim 108, wherein:

the one or more DNA molecules comprising the nucleotide sequences that encode the DNA-targeting RNA, and/or the DNA molecule comprising the nucleotide sequence that encodes the Cas9 protein, are vectors selected from the group consisting of plasmids and viral vectors.

111. The method of claim 108, wherein said CRISPR-Cas system comprises two or more DNA-targeting RNAs, or one or more DNA molecules comprising two or more nucleotide sequences encoding DNA-targeting RNAs.

112. A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the DNA molecule, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,

thereby targeting the Cas9 protein to the target sequence,

wherein said contacting occurs within a cell, but outside of a bacterial cell and outside of an archaeal cell.

113. The method of claim 112, wherein said contacting results in modification of the DNA molecule.

114. The method of claim 112, wherein said contacting results in cleavage of the DNA molecule.

115. The method of claim 114, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

116. The method of claim 112, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

117. The method of claim 112, wherein the Cas9 protein is fused to a heterologous polypeptide.

118. The method of claim 117, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

119. The method of claim 112, wherein the nucleotide sequence that is complementary to the target sequence is 19 nucleotides (nt) to 20 nt long.

120. The method of claim 112, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

121. The method of claim 112, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

122. The method of claim 112, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

123. The method of claim 112, wherein the DNA molecule is chromosomal DNA.

124. A method of modifying a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the DNA molecule, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,

wherein said contacting occurs within a cell, but outside of a bacterial cell and outside of an archaeal cell, and

wherein said contacting results in modification of the DNA molecule.

125. The method of claim 124, wherein said modification is cleavage of the DNA molecule.

126. The method of claim 125, wherein the Cas9 protein comprises a mutation in a RuvC domainor an HNH domain and can cleave only one strand of DNA.

127. The method of claim 124, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

128. The method of claim 124, wherein the Ca9 protein is fused to a heterologous polypeptide.

129. The method of claim 128, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

130. The method of claim 124, wherein the nucleotide sequence that is complementary to the target sequence is 19 nucleotides (nt) to 20 nt long.

131. The method of claim 124, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

132. The method of claim 124, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

133. The method of claim 124, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

134. The method of claim 124, wherein the DNA molecule is chromosomal DNA.

135. A method of cleaving a DNA molecule, the method comprising:

contacting a DNA molecule with a complex comprising;

(a) a Cas9 protein, and

(b) a DNA-targeting RNA that comprises;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the DNA molecule, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,

wherein said contacting occurs in a cell, but outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in cleavage of the DNA molecule.

136. The method of claim 135, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

137. The method of claim 135, wherein the Ca9 protein is fused to a heterologous polypeptide.

138. The method of claim 135, wherein the nucleotide sequence that is complementary to the target sequence is 19 nucleotides (nt) to 20 nt long.

139. The method of claim 135, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

140. The method of claim 135, comprising contacting the DNA molecule with more different DNA-targeting RNAs.

141. The method of claim 135, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

142. The method of claim 135, wherein the DNA molecule is chromosomal DNA.

143. A method of targeting and binding a target DNA,

modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a polypeptide associated with a target DNA, the method comprising:

contacting a target DNA with an engineered non-naturally occurring complex comprising;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,

wherein;

the engineered non-naturally occurring complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a polypeptide associated with the target DNA is modified.

144. The method of claim 143, wherein said contacting results in modification of the target DNA.

145. The method of claim 143, wherein said contacting results in cleavage of the target DNA.

146. The method of claim 145, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

147. The method of claim 143, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

148. The method of claim 143, wherein the Ca9 protein is fused to a heterologous polypeptide.

149. The method of claim 148, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

150. The method of claim 143, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 19 nucleotides (nt) to 20 nt long.

151. The method of claim 143, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

152. The method of claim 143, comprising contacting the target DNA with two or more different DNA-targeting RNAs.

153. The method of claim 143, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

154. The method of claim 143, wherein the target DNA is chromosomal DNA.

155. The method of claim 143, wherein said contacting comprises introducing into a cell containing the target DNA, one or more of:

the activator-RNA, or a nucleic acid encoding the activator-RNA;

the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and

the Cas9 protein, or a nucleic acid encoding the Cas9 protein.

156. The method of claim 155, wherein at least one of:

the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein is a plasmid or a viral vector.

157. The method of claim 155, further comprising introducing into the cell a donor polynucleotide.

158. The method of claim 155, wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.

159. The method of claim 155, wherein an (1) mRNA encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.

160. The method of claim 155, wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.

161. The method of claim 155, wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.

162. A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,

wherein the Cas9 protein is fused to a heterologous polypeptide,

wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified.

163. A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,

wherein the Cas9 protein is covalently linked to a protein transduction domain,

wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified.

164. A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA comprising;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,

wherein the target DNA is chromosomal DNA,

wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified.

165. A composition comprising:

a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises;

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule,

wherein the target DNA molecule is chromosomal DNA.

166. A composition comprising:

one or more nucleic acids encoding a DNA-targeting RNA, wherein the DNA-targeting RNA comprises;

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,

wherein the targeter-RNA or activator-RNA, or both, is encoded by a nucleotide sequence operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence,

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

167. A composition comprising:

a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises;

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and

wherein the composition is characterized by one or more of;

(A) the target DNA molecule is chromosomal DNA;

(B) one or more of;

the targeter-RNA, the activator-RNA, and the one or more nucleic acids encoding the DNA-targeting RNA, are conjugated to a heterologous moiety; and

(C) the targeter-RNA or activator-RNA, or both, encoded by the one or more nucleic acids, is encoded by a nucleotide sequence operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence.

168. The composition of claim 167, further comprising a Cas9 protein, or a nucleic acid encoding the Cas9 protein.

169. The composition of claim 168, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

170. The composition of claim 168, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

171. The composition of claim 168, wherein the Cas9 protein is fused to a heterologous polypeptide.

172. The composition of claim 171, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

173. The composition of claim 168, wherein the Cas9 protein is covalently linked to a protein transduction domain.

174. The composition of claim 167, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA molecule is 19 nucleotides (nt) to 20 nt long.

175. The composition of claim 167, wherein the DNA molecule is chromosomal DNA.

177. A cell comprising the composition of claim 167.

178. A cell comprising the composition of claim 168.

176. A composition comprising:

a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises;

(a) a targeter-RNA, which has one DNA-targeting segment that comprises a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and

wherein the composition is characterized by one or more of;

(A) the target DNA molecule is chromosomal DNA;

(B) one or more of;

the targeter-RNA, the activator-RNA, and the one or more nucleic acids encoding the DNA-targeting RNA, are conjugated to a heterologous moiety; and

(C) the targeter-RNA or activator-RNA, or both, encoded by the one or more nucleic acids, is encoded by a nucleotide sequence operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence.

179. A eukaryotic cell comprising a target DNA molecule and an engineered and/or non-naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR associated (Cas) (CRISPR-Cas) system comprising

a) a Cas9 protein, or a nucleic acid comprising a nucleotide sequence encoding said Cas9 protein;

and

b) a single molecule DNA-targeting RNA, or a nucleic acid comprising a nucleotide sequence encoding said single molecule DNA-targeting RNA;

wherein the single molecule DNA-targeting RNA comprises;

i) a targeter-RNA that is capable of hybridizing with a target sequence in the target DNA molecule, and

ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment,

wherein the activator-RNA and the targeter-RNA are covalently linked to one another with intervening nucleotides; and

wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein, thereby targeting the Cas9 protein to the target DNA molecule,

whereby said system is capable of cleaving or editing the target DNA molecule or modulating transcription of at least one gene encoded by the target DNA molecule.

180. The eukaryotic cell of claim 179, wherein the genome of said eukaryotic cell comprises the target DNA molecule.

181. The eukaryotic cell of claim 179, wherein the eukaryotic cell is a mammalian cell or a human cell.

182. The eukaryotic cell of claim 179, wherein one or both of the nucleic acids of a) and b) are one or more vectors, wherein the nucleotide sequence encoding said Cas9 protein and/or the nucleotide sequence encoding said single molecule DNA-targeting RNA is operably linked to a control element operable in said eukaryotic cell.

183. The eukaryotic cell of claim 182, wherein the one or more vectors are selected from the group consisting of plasmids and viral vectors.

184. The eukaryotic cell of claim 183, wherein the viral vector is an adeno-associated virus vector.

185. The eukaryotic cell of claim 182, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

186. The eukaryotic cell of claim 185, wherein the one or more PTD(s) aid in traversal of an organelle membrane.

187. The eukaryotic cell of claim 182, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

188. The eukaryotic cell of claim 179, comprising two or more single molecule DNA-targeting RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding single molecule DNA-targeting RNAs.

189. The eukaryotic cell of claim 179, wherein the system comprises a donor polynucleotide and the system is capable of editing the target DNA molecule by inserting a sequence of the donor polynucleotide into a cleaved strand of the target DNA molecule.

190. The eukaryotic cell of claim 179, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

191. The eukaryotic cell of claim 190, wherein the one or more PTD(s) aid in traversal of an organelle membrane.

192. The eukaryotic cell of claim 191, wherein said Cas9 protein comprises one or more mutations in a RuvC domain or a HNH domain and is capable of cleaving only one strand of DNA.

193. The eukaryotic cell of claim 179, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

194. The eukaryotic cell of claim 179, wherein the nucleotide sequence encoding said Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

195. The eukaryotic cell of claim 179, wherein said Cas9 protein is capable of cleaving only one strand of DNA and comprises one or more mutations in a RuvC domain and/or a HNH domain.

196. The eukaryotic cell of claim 195, comprising two or more single molecule DNA-targeting RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding single molecule DNA-targeting RNAs.

197. The eukaryotic cell of claim 195, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

198. The eukaryotic cell of claim 197, wherein the one or more PTD(s) aid in traversal of an organelle membrane.

199. A non-human plant or animal comprising the eukaryotic cell of claim 179.

200. A eukaryotic cell comprising a target DNA molecule and an engineered and/or non-naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system

comprising a Cas9 protein or a nucleic acid comprising a nucleotide sequence encoding the Cas9 protein, and

a DNA-targeting RNA or one or more nucleic acids comprising one or more nucleotide sequences encoding the DNA-targeting RNA;

wherein the DNA-targeting RNA comprises i) a targeter-RNA that is capable of hybridizing with a target sequence in a target DNA molecule, and ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment,

wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9 proteins,

whereby hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA molecule.

201. The eukaryotic cell of claim 200, wherein the genome of said eukaryotic cell comprises the target DNA molecule.

202. The eukaryotic cell of claim 200, wherein the eukaryotic cell is a mammalian cell or a human cell.

203. The eukaryotic cell of claim 200, comprising two or more different targeter-RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding different targeter-RNAs.

204. The eukaryotic cell of claim 200, wherein the system comprises a nucleic acid molecule comprising a nucleotide sequence encoding the activator-RNA, and wherein said nucleic acid molecule comprising a nucleotide sequence encoding the activator-RNA does not comprise a nucleotide sequence encoding said Cas9 protein.

205. The eukaryotic cell of claim 200, wherein the system comprises a double stranded DNA molecule comprising nucleotide sequences encoding both the activator-RNA and the targeter-RNA, wherein the nucleotide sequences encoding the targeter-RNA and the activator-RNA are on the same strand.

206. The eukaryotic cell of claim 200, wherein one or more of a) the nucleic acid comprising the nucleotide sequence encoding said Cas9 protein and b) the one or more nucleic acids comprising one or more nucleotide sequences encoding said DNA-targeting RNA, are one or more vectors, wherein the one or more vectors are selected from the group consisting of plasmids, viral, and adeno-associated virus vectors;

and wherein the nucleotide sequence encoding said Cas9 protein and/or the one or more nucleotide sequence encoding said DNA-targeting RNA is operably linked to a control element operable in said eukaryotic cell.

207. The eukaryotic cell of claim 200, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

208. The eukaryotic cell of claim 207, wherein the one or more PTD(s) aid in traversal of an organelle membrane.

209. The eukaryotic cell of claim 200, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

210. The eukaryotic cell of claim 200, comprising two or more different DNA-targeting RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

211. The eukaryotic cell of claim 200, wherein the system comprises a donor polynucleotide and the system is capable of editing the target DNA molecule by inserting a sequence of the donor polynucleotide into a cleaved strand of the target DNA molecule.

212. The eukaryotic cell of claim 200, wherein the nucleotide sequence encoding said Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

213. The eukaryotic cell of claim 200, wherein said Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain and is capable of cleaving only one strand of DNA.

214. The eukaryotic cell of claim 213, wherein the nucleotide sequence encoding said Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

215. The eukaryotic cell of claim 213, comprising two or more different DNA-targeting RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

216. The eukaryotic cell of claim 213, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

217. The eukaryotic cell of claim 200, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

222. A non-human plant or animal comprising the eukaryotic cell of claim 200.

218. A eukaryotic cell comprising a target DNA and an engineered and/or non-naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR associated (Cas) (CRISPR-Cas) system comprising

a) a Cas9 protein, or a nucleic acid comprising a nucleotide sequence encoding said Cas9 protein;

and

b) a DNA-targeting RNA, or one or more nucleic acids comprising one or more nucleotide sequences encoding said DNA-targeting RNA;

wherein the DNA-targeting RNA comprises;

i) a targeter-RNA that is capable of hybridizing with a target sequence in the target DNA molecule, and ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment;

wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9 proteins,

wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein, thereby targeting the Cas9 protein to the target DNA molecule, whereby said system is capable of cleaving or editing the target DNA molecule or modulating transcription of at least one gene encoded by the target DNA molecule.

219. The eukaryotic cell of claim 218, wherein one or more of the nucleic acids of a) and b) are one or more vectors, wherein the one or more vectors are selected from the group consisting of plasmids, viral, and adeno-associated virus vectors;

wherein the nucleotide sequence encoding said Cas9 protein and/or the one or more nucleotide sequence encoding said DNA-targeting RNA are operably linked to control elements operable in said eukaryotic cell.

220. The eukaryotic cell of claim 218, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

221. The eukaryotic cell of claim 220, wherein said Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain and is capable of cleaving only one strand of DNA.

223. A eukaryotic cell comprising a target DNA molecule and an engineered and/or non-naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising

a Cas9 protein or a nucleic acid comprising a nucleotide sequence encoding the Cas9 protein, and

a DNA-targeting RNA or one or more nucleic acids comprising one or more nucleotide sequences encoding the DNA-targeting RNA;

wherein the DNA-targeting RNA comprises

i) a targeter-RNA that is capable of hybridizing with a target sequence in a target DNA molecule, and

ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment,

whereby hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA molecule.

224. The eukaryotic cell of claim 223, wherein the genome of said eukaryotic cell comprises the target DNA molecule.

225. The eukaryotic cell of claim 223, wherein the eukaryotic cell is a mammalian cell or a human cell.

226. The eukaryotic cell of claim 223, comprising two or more different targeter-RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding different targeter-RNAs.

227. The eukaryotic cell of claim 223, wherein the system comprises a nucleic acid molecule comprising a nucleotide sequence encoding the activator-RNA, and wherein said nucleic acid molecule comprising a nucleotide sequence encoding the activator-RNA does not comprise a nucleotide sequence encoding said Cas9 protein.

228. The eukaryotic cell of claim 223, wherein the system comprises a double stranded DNA molecule comprising nucleotide sequences encoding both the activator-RNA and the targeter-RNA, wherein the nucleotide sequences encoding the targeter-RNA and the activator-RNA are on the same strand.

229. The eukaryotic cell of claim 223, wherein one or more of the nucleic acids of a) the nucleic acid comprising the nucleotide sequence encoding said Cas9 protein and b) the one or more nucleic acids comprising one or more nucleotide sequences encoding said DNA-targeting RNA, are one or more vectors, wherein the one or more vectors are selected from the group consisting of plasmids, viral, retroviral, and adeno-associated virus vectors;

and wherein the nucleotide sequence encoding said Cas9 protein and/or the one or more nucleotide sequences encoding said DNA-targeting RNA is operably linked to a control element operable in said eukaryotic cell.

230. The eukaryotic cell of claim 223, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

231. The eukaryotic cell of claim 230, wherein the one or more PTD(s) aid in traversal of an organelle membrane.

232. The eukaryotic cell of claim 223, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

233. The eukaryotic cell of claim 223, comprising two or more different DNA-targeting RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

234. The eukaryotic cell of claim 223, wherein the system comprises a donor polynucleotide and the system is capable of editing the target DNA molecule by inserting a sequence of the donor polynucleotide into a cleaved strand of the target DNA molecule.

235. The eukaryotic cell of claim 223, wherein the nucleotide sequence encoding said Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

236. The eukaryotic cell of claim 223, wherein said Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain and is capable of cleaving only one strand of DNA.

237. The eukaryotic cell of claim 236, wherein the nucleotide sequence encoding said Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

238. The eukaryotic cell of claim 236, comprising two or more different DNA-targeting RNAs, or one or more nucleic acids comprising two or more nucleotide sequences encoding different DNA-targeting RNAs.

239. The eukaryotic cell of claim 236, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

240. The eukaryotic cell of claim 223, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.

245. A non-human plant or animal comprising the eukaryotic cell of claim 223.

241. A eukaryotic cell comprising a target DNA and an engineered and/or non-naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising

a) a Cas9 protein, or a nucleic acid comprising a nucleotide sequence encoding said Cas9 protein;

and

b) a DNA-targeting RNA, or one or more nucleic acids comprising one or more nucleotide sequences encoding said DNA-targeting RNA;

wherein the DNA-targeting RNA comprises;

i) a targeter-RNA that is capable of hybridizing with a target sequence in the target DNA molecule, and

ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment;

wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein, thereby targeting the Cas9 protein to the target DNA molecule,

whereby said system is capable of cleaving or editing the target DNA molecule or modulating transcription of at least one gene encoded by the target DNA molecule.

242. The eukaryotic cell of claim 241, wherein one or more of the nucleic acids of a) and b) are one or more vectors, wherein the one or more vectors are selected from the group consisting of plasmids, viral, and adeno-associated virus vectors;

wherein the nucleotide sequence encoding said Cas9 protein and/or the one or more nucleotide sequence encoding said DNA-targeting RNA are operably linked to control elements operable in said eukaryotic cell.

243. The eukaryotic cell of claim 241, wherein the Cas9 protein comprises one or more Protein Transduction Domain(s) (PTD(s)).

244. The eukaryotic cell of claim 243, wherein said Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain and is capable of cleaving only one strand of DNA.

246. A method of modifying a DNA molecule, cleaving a DNA molecule, and/or targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, comprising

(i) a first nucleotide sequence that is not found in naturally occurring crRNA, and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and

(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,

thereby modifying the DNA molecule, cleaving the DNA molecule, and/or targeting the Cas9 protein to the target sequence of the DNA molecule.

247. The method of claim 246, wherein said contacting results in modification of the DNA molecule.

248. The method of claim 246, wherein said contacting results in cleavage of the DNA molecule.

249. The method of claim 248, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

250. The method of claim 246, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

251. The method of claim 246, wherein the Ca9 protein is fused to a heterologous polypeptide.

252. The method of claim 251, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

253. The method of claim 246, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

254. The method of claim 246, wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.

255. The method of claim 246, wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.

256. The method of claim 246, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

257. The method of claim 246, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

258. The method of claim 246, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

259. The method of claim 246, wherein the DNA molecule is chromosomal DNA.

260. The method of claim 246, wherein said contacting comprises introducing into a cell containing the DNA molecule, one or more of:

the activator-RNA, or a nucleic acid encoding the activator-RNA;

the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and

the Cas9 protein, or a nucleic acid encoding the Cas9 protein.

261. The method of claim 260, wherein at least one of:

the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein;

is a plasmid or a viral vector.

262. The method of claim 260, further comprising introducing into the cell a donor polynucleotide.

263. The method of claim 260, wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.

264. The method of claim 260, wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.

265. The method of claim 260, wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.

266. A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, comprising

(i) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and

(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,

thereby targeting the Cas9 protein to the target sequence,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell.

267. The method of claim 266, wherein said contacting results in modification of the DNA molecule.

268. The method of claim 266, wherein said contacting results in cleavage of the DNA molecule.

269. The method of claim 268, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

270. The method of claim 266, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

271. The method of claim 266, wherein the Ca9 protein is fused to a heterologous polypeptide.

272. The method of claim 271, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

273. The method of claim 266, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

274. The method of claim 266, wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.

275. The method of claim 266, wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.

276. The method of claim 266, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

277. The method of claim 266, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

278. The method of claim 266, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

279. The method of claim 266, wherein the DNA molecule is chromosomal DNA.

280. A method of modifying a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, comprising

(i) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and

(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell, and

wherein said contacting results in modification of the DNA molecule.

281. The method of claim 280, wherein said modification is cleavage of the DNA molecule.

282. The method of claim 281, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

283. The method of claim 280, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

284. The method of claim 280, wherein the Ca9 protein is fused to a heterologous polypeptide.

285. The method of claim 284, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

286. The method of claim 280, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

287. The method of claim 280, wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.

288. The method of claim 280, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

289. The method of claim 280, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

290. The method of claim 280, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

291. The method of claim 280, wherein the DNA molecule is chromosomal DNA.

292. A method of cleaving a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, comprising

(i) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and

(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell, and

wherein said contacting results in cleavage of the DNA molecule.

293. The method of claim 292, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

294. The method of claim 292, wherein the Ca9 protein is fused to a heterologous polypeptide.

295. The method of claim 292, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

296. The method of claim 292, wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.

297. The method of claim 292, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

298. The method of claim 292, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

299. The method of claim 292, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

300. The method of claim 292, wherein the DNA molecule is chromosomal DNA.

301. A method of modifying a DNA molecule, cleaving a DNA molecule, and/or targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(I) a Cas9 protein; and

(II) a DNA-targeting RNA that comprises;

(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

(B) the targeter-RNA, comprising;

(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and

(b) a DNA-targeting segment that is fused to and positioned 5′

of the duplex-forming segment,

wherein the DNA-targeting segment;

(i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,

thereby modifying the DNA molecule, cleaving the DNA molecule, and/or targeting the Cas9 protein to the target sequence of the DNA molecule.

302. The method of claim 301, wherein said contacting results in modification of the DNA molecule.

303. The method of claim 301, wherein said contacting results in cleavage of the DNA molecule.

304. The method of claim 303, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

305. The method of claim 301, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

306. The method of claim 301, wherein the Ca9 protein is fused to a heterologous polypeptide.

307. The method of claim 306, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

308. The method of claim 301, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

309. The method of claim 301, wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.

310. The method of claim 301, wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.

311. The method of claim 301, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

312. The method of claim 301, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

313. The method of claim 301, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

314. The method of claim 301, wherein the DNA molecule is chromosomal DNA.

315. The method of claim 301, wherein said contacting comprises introducing into a cell containing the DNA molecule, one or more of:

the activator-RNA, or a nucleic acid encoding the activator-RNA;

the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and

the Cas9 protein, or a nucleic acid encoding the Cas9 protein.

316. The method of claim 315, wherein at least one of:

the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein;

is a plasmid or a viral vector.

317. The method of claim 315, further comprising introducing into the cell a donor polynucleotide.

318. The method of claim 315, wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.

319. The method of claim 315, wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.

320. The method of claim 315, wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.

321. A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(I) a Cas9 protein; and

(II) a DNA-targeting RNA that comprises;

(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

(B) the targeter-RNA, comprising;

(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and

(b) a DNA-targeting segment that is fused to and positioned 5′

of the duplex-forming segment,

wherein the DNA-targeting segment;

(i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,

thereby targeting the Cas9 protein to the target sequence,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell.

322. The method of claim 321, wherein said contacting results in modification of the DNA molecule.

323. The method of claim 321, wherein said contacting results in cleavage of the DNA molecule.

324. The method of claim 321, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

325. The method of claim 321, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

326. The method of claim 321, wherein the Ca9 protein is fused to a heterologous polypeptide.

327. The method of claim 326, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

328. The method of claim 321, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

329. The method of claim 321, wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.

330. The method of claim 321, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

331. The method of claim 321, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

332. The method of claim 321, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

333. The method of claim 321, wherein the DNA molecule is chromosomal DNA.

334. A method of modifying a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(I) a Cas9 protein; and

(II) a DNA-targeting RNA that comprises;

(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

(B) the targeter-RNA, comprising;

(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and

(b) a DNA-targeting segment that is fused to and positioned 5′

of the duplex-forming segment,

wherein the DNA-targeting segment;

(i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell, and

wherein said contacting results in modification of the DNA molecule.

335. The method of claim 334, wherein said modification is cleavage of the DNA molecule.

336. The method of claim 335, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

337. The method of claim 334, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

338. The method of claim 334, wherein the Ca9 protein is fused to a heterologous polypeptide.

339. The method of claim 338, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

340. The method of claim 334, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

341. The method of claim 334, wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.

342. The method of claim 334, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

343. The method of claim 334, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

344. The method of claim 334, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

345. The method of claim 334, wherein the DNA molecule is chromosomal DNA.

346. A method of cleaving a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(I) a Cas9 protein; and

(II) a DNA-targeting RNA that comprises;

(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

(B) the targeter-RNA, comprising;

(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and

(b) a DNA-targeting segment that is fused to and positioned 5′

of the duplex-forming segment, wherein the DNA-targeting segment;

(i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and

(ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell, and

wherein said contacting results in cleavage of the DNA molecule.

347. The method of claim 346, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

348. The method of claim 346, wherein the Ca9 protein is fused to a heterologous polypeptide.

349. The method of claim 346, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

350. The method of claim 346, wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.

351. The method of claim 346, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

352. The method of claim 346, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

353. The method of claim 346, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

354. The method of claim 346, wherein the DNA molecule is chromosomal DNA.

355. A method of modifying a DNA molecule, cleaving a DNA molecule, and/or targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,

thereby modifying the DNA molecule, cleaving the DNA molecule, and/or targeting the Cas9 protein to the target sequence of the DNA molecule.

356. The method of claim 355, wherein said contacting results in modification of the DNA molecule.

357. The method of claim 355, wherein said contacting results in cleavage of the DNA molecule.

358. The method of claim 357, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

359. The method of claim 355, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

360. The method of claim 355, wherein the Ca9 protein is fused to a heterologous polypeptide.

361. The method of claim 360, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

362. The method of claim 355, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

363. The method of claim 355, wherein the target sequence is 18 nucleotides (nt) to 25 nt long.

364. The method of claim 355, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

365. The method of claim 355, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

366. The method of claim 355, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

367. The method of claim 355, wherein the DNA molecule is chromosomal DNA.

368. The method of claim 355, wherein said contacting comprises introducing into a cell containing the DNA molecule, one or more of:

the activator-RNA, or a nucleic acid encoding the activator-RNA;

the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and

the Cas9 protein, or a nucleic acid encoding the Cas9 protein.

369. The method of claim 368, wherein at least one of:

the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein;

is a plasmid or a viral vector.

370. The method of claim 368, further comprising introducing into the cell a donor polynucleotide.

371. The method of claim 368, wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.

372. The method of claim 368, wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.

373. The method of claim 368, wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.

374. A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,

thereby targeting the Cas9 protein to the target sequence,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell.

375. The method of claim 374, wherein said contacting results in modification of the DNA molecule.

376. The method of claim 374, wherein said contacting results in cleavage of the DNA molecule.

377. The method of claim 376, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

378. The method of claim 374, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

379. The method of claim 374, wherein the Ca9 protein is fused to a heterologous polypeptide.

380. The method of claim 379, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

381. The method of claim 374, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

382. The method of claim 374, wherein the target sequence is 18 nucleotides (nt) to 25 nt long.

383. The method of claim 374, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

384. The method of claim 374, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

385. The method of claim 374, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

386. The method of claim 374, wherein the DNA molecule is chromosomal DNA.

387. A method of modifying a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell, and

wherein said contacting results in modification of the DNA molecule.

388. The method of claim 387, wherein said modification is cleavage of the DNA molecule.

389. The method of claim 388, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

390. The method of claim 387, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

391. The method of claim 387, wherein the Ca9 protein is fused to a heterologous polypeptide.

392. The method of claim 391, wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.

393. The method of claim 387, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

394. The method of claim 387, wherein the target sequence is 18 nucleotides (nt) to 25 nt long.

395. The method of claim 387, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

396. The method of claim 387, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

397. The method of claim 387, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

398. The method of claim 387, wherein the DNA molecule is chromosomal DNA.

399. A method of cleaving a DNA molecule, the method comprising:

contacting a DNA molecule with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and

the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,

wherein said contacting occurs in a cell outside of a bacterial cell and outside of an archaeal cell, and

wherein said contacting results in cleavage of the DNA molecule.

400. The method of claim 399, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.

401. The method of claim 399, wherein the Ca9 protein is fused to a heterologous polypeptide.

402. The method of claim 399, wherein the Cas9 protein is covalently linked, at its C-terminus, to a protein transduction domain.

403. The method of claim 399, wherein the target sequence is 18 nucleotides (nt) to 25 nt long.

404. The method of claim 399, wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein;

and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.

405. The method of claim 399, comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.

406. The method of claim 399, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.

407. The method of claim 399, wherein the DNA molecule is chromosomal DNA.

408. A method for site-specific modification of a target DNA molecule, the method comprising:

(A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising;

(i) a Cas9 protein;

(ii) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA molecule; and

(iii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein,

wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and

(B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,

wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and

wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.

409. The method of claim 408, wherein the nucleotide sequence of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long.

410. The method of claim 408, wherein the nucleotide sequence, of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long.

411. The method of claim 410, wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No:

568) which is positioned 3′

of the nucleotide sequence that is complementary to the target sequence of the target DNA molecule.

412. The method of claim 408, wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain.

413. The method of claim 408, wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis;

and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis.

414. The method of claim 413, wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified host cell.

415. The method of claim 413, wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified host cell.

416. The method of claim 415, wherein the genetically modified host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a cell to result in the genetically modified host cell.

417. A method for site-specific modification of a target DNA molecule, the method comprising:

(1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA,

wherein the targeter-RNA comprises a nucleotide sequence that is complementary to a target sequence of the target DNA molecule, and the targeter-RNA and activator-RNA hybridize with one another to form a duplex;

(2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and

(3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,

wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and

wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.

418. The method of claim 417, wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long.

419. The method of claim 417, wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long.

420. The method of claim 417, wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain.

421. The method of claim 417, wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis;

and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis.

422. A method for site-specific modification of a target DNA molecule, the method comprising:

(A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising;

(i) a Cas9 protein;

(ii) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA molecule; and

(iii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein,

wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and

(B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,

wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule,

wherein the Cas9 protein and the DNA-targeting RNA do not naturally occur together, and

wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.

423. The method of claim 422, wherein the nucleotide sequence of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long.

424. The method of claim 422, wherein the nucleotide sequence, of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long.

425. The method of claim 422, wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain.

426. The method of claim 422, wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis;

and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis.

427. The method of claim 426, wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified host cell.

428. The method of claim 426, wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified host cell.

429. The method of claim 428, wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a cell to result in the genetically modified host cell.

430. A method for site-specific modification of a target DNA molecule, the method comprising:

(1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA, wherein the targeter-RNA comprises a nucleotide sequence that is complementary to a target sequence of the target DNA molecule, and the targeter-RNA and activator-RNA hybridize with one another to form a duplex;

(2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and

(3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,

wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule,

wherein the Cas9 protein and the DNA-targeting RNA do not naturally occur together, and

wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.

431. The method of claim 430, wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long.

432. The method of claim 430, wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long.

433. The method of claim 430, wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain.

434. The method of claim 430, wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis;

and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis.

435. The method of claim 434, wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified host cell.

436. The method of claim 435, wherein the genetically modified host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a cell to result in the genetically modified host cell.

437. A composition comprising a DNA-targeting RNA or a nucleic acid encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the targeter-RNA and the activator-RNA are covalently linked, and

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

438. The composition of claim 437, wherein the nucleic acid encoding the DNA-targeting RNA is a plasmid or a viral vector.

439. The composition of claim 437, wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence

440. The composition of claim 437, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence

441. A composition comprising a DNA-targeting RNA or a nucleic acid encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 9 to 11 base pairs,

wherein the targeter-RNA and activator-RNA are covalently linked, and

wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

442. The composition of claim 441, wherein the nucleic acid encoding the DNA-targeting RNA is a plasmid or a viral vector.

443. The composition of claim 441, wherein the activator-RNA comprises the 26 nucleotide tracrRNA set forth in SEQ ID NO:

441.

444. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the targeter-RNA and the activator-RNA are covalently linked,

and wherein;

the complex binds to the target DNA,

the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

445. The method of claim 444, wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell.

446. The method of claim 445, wherein the eukaryotic cell is a mammalian cell.

447. The method of claim 444, wherein the method comprises introducing into the bacterial cell or the eukaryotic cell:

(1) the DNA-targeting RNA, or a nucleic acid that encodes the DNA-targeting RNA; and

/or

(2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

448. The method of claim 444, wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell.

449. The method of claim 444, wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

450. The method of claim 444, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

451. The method of claim 444, wherein the Cas9 protein is capable of cleaving only one strand of DNA and comprises one or more mutations in a RuvC domain or an HNH domain.

452. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a DNA-targeting RNA that comprises;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 9-11 base pairs,

wherein the targeter-RNA and the activator-RNA are covalently

and wherein;

the complex binds to the target DNA,

the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

453. The method of claim 452, wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell.

454. The method of claim 453, wherein the eukaryotic cell is a mammalian cell.

455. The method of claim 453, wherein the method comprises introducing into the bacterial cell or the eukaryotic cell:

(1) the DNA-targeting RNA, or a nucleic acid that encodes the DNA-targeting RNA; and

/or

(2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

456. The method of claim 453, wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell.

457. The method of claim 452, wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

458. The method of claim 452, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or an HNH domain.

459. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

(a) a Cas9 protein; and

(b) a single molecule DNA-targeting RNA that comprises, in 5′

to 3′

order;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein (i) and (ii) are covalently linked by intervening nucleotides,

and

wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

460. The method of claim 459, wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell.

461. The method of claim 460, wherein the eukaryotic cell is a mammalian cell.

462. The method of claim 460, wherein the method comprises introducing into the bacterial cell or the eukaryotic cell:

(1) the single molecule DNA-targeting RNA, or a nucleic acid that encodes the single molecule DNA-targeting RNA; and

/or

(2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

463. The method of claim 460, wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell.

464. The method of claim 459, wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

465. The method of claim 459, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

466. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:

contacting a target DNA with a complex that comprises;

a) a Cas9 protein; and

(b) a single molecule DNA-targeting RNA that comprises, in 5′

to 3′

order;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs,

wherein (i) and (ii) are covalently linked by intervening nucleotides,

and wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

467. The method of claim 466, wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell.

468. The method of claim 467, wherein the eukaryotic cell is a mammalian cell.

469. The method of claim 467, wherein the method comprises introducing into the bacterial cell or the eukaryotic cell:

(1) the single molecule DNA-targeting RNA, or a nucleic acid that encodes the single molecule DNA-targeting RNA; and

/or

(2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

470. The method of claim 467, wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell.

471. The method of claim 466, wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

472. The method of claim 466, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or an HNH domain.

473. A composition comprising a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′

to 3′

order;

i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 9-11 base pairs,

wherein (i) and (ii) are covalently linked by intervening nucleotides, and

wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

474. The composition of claim 473, wherein the nucleic acid encoding the single molecule DNA-targeting RNA is a plasmid or a viral vector.

475. The composition of claim 473, wherein the activator-RNA comprises the 64 nucleotide tracrRNA sequence

476. The composition of claim 473, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence

477. A single molecule DNA-targeting RNA, or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises,

in 5′

to 3′

order;

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 9-11 base pairs,

wherein (i) and (ii) are covalently linked by intervening nucleotides, and

wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

478. The composition of claim 477, wherein the nucleic acid encoding the single molecule DNA-targeting RNA is a plasmid or a viral vector.

479. The composition of claim 477, wherein the activator-RNA comprises the 26 nucleotide tracrRNA set forth in SEQ ID NO:

441.

480. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:

contacting a target DNA inside of a cell with a complex that comprises;

(a) a Cas9 protein; and

(b) a non-naturally occurring DNA-targeting RNA comprising;

(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 9-11 base pairs,

wherein;

the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

481. The method of claim 480, wherein the target sequence of the target DNA is 18 nucleotides (nt) to 25 nt long.

482. The method of claim 480, wherein said contacting comprises inducing expression of (a).

483. The method of claim 480, wherein said contacting comprises introducing into the cell one or more of:

(1) the Cas9 protein, or a nucleic acid encoding the Cas9 protein;

(2) the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and

(3) the activator-RNA, or a nucleic acid encoding the activator-RNA.

484. The method of claim 483, wherein one or more of:

(A) the nucleic acid encoding the Cas9 protein;

(B) the nucleic acid encoding the targeter-RNA; and

(C) the nucleic acid encoding the activator-RNA,

is a plasmid or a viral vector.

485. The method of claim 483, comprising introducing into the cell (1), (2), and (3).

486. The method of claim 483, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

487. The method of claim 480, wherein the method comprises introducing a donor polynucleotide into the cell.

488. The method of claim 480, wherein the targeter-RNA and the activator-RNA are covalently linked via the 3′

end of the targeter-RNA and the 5′

end of the activator-RNA.

489. The method of claim 480, wherein the method comprises introducing two or more of the non-naturally occurring DNA-targeting RNAs into the cell, wherein the two or more non-naturally occurring DNA-targeting RNAs are complementary to different target sequences within the same or different target DNAs.

490. The method of claim 480, wherein the cell is a bacterial cell or a eukaryotic cell.

491. The method of claim 480, wherein the eukaryotic cell is a mammalian cell.

492. The method of claim 480, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

493. The method of claim 480, wherein the Cas9 protein is fused to a heterologous polypeptide.

494. The method of claim 480, wherein the targeter-RNA and the activator-RNA are not covalently linked by intervening nucleotides.

495. The method of claim 480, wherein the targeter-RNA and the activator-RNA are conjugated to a heterologous moiety.

496. The method of claim 480, wherein the target DNA is chromosomal DNA.

497. The method of claim 480, wherein the activator-RNA comprises the 64 nucleotide tracrRNA sequence

498. The method of claim 480, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

499. The method of claim 480, wherein said contacting results in cleavage of the target DNA.

500. The method of claim 480, wherein the Cas9 protein is capable of cleaving only one strand of DNA and comprises one or more mutations in a RuvC domain or an HNH domain.

501. A non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:

(a) a targeter-RNA comprising;

(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and (ii) a second nucleotide sequence that hybridizes with an activator-RNA,

wherein the first and second nucleotide sequences are heterologous to one another; and

(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

502. The non-naturally occurring DNA-targeting RNA of claim 501, or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 10 to 15 base pairs.

503. The non-naturally occurring DNA-targeting RNA of claim 501, or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 10 base pairs.

504. The non-naturally occurring DNA-targeting RNA of claim 501, or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 20 nt long.

505. The non-naturally occurring DNA-targeting RNA of claim 501, or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the target DNA molecule is chromosomal DNA.

506. The non-naturally occurring DNA-targeting RNA of claim 501, or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence

507. The non-naturally occurring DNA-targeting RNA of claim 501, or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence

508. The non-naturally occurring DNA-targeting RNA of claim 501, or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA is conjugated to a heterologous moiety.

509. One or more nucleic acids encoding a non-naturally occurring DNA-targeting RNA that comprises:

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and wherein the one or more nucleic acids comprises a first nucleotide sequence encoding the targeter-RNA and a second nucleotide sequence encoding the activator-RNA;

wherein the first nucleotide sequence, the second nucleotide sequence, or both, is operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence.

510. The one or more nucleic acids of claim 509, wherein the one or more nucleic acids are one or more recombinant expression vectors.

511. The one or more nucleic acids of claim 509, wherein the one or more nucleic acids are plasmids or viral vectors.

512. The one or more nucleic acids of claim 509, wherein the one or more nucleic acids are adeno-associated viral vectors.

513. The one or more nucleic acids of claim 509, wherein the first nucleotide sequence is operably linked to said heterologous transcriptional control sequence, wherein said heterologous transcriptional control sequence is a promoter.

514. The one or more nucleic acids of claim 509, wherein the second nucleotide sequence is operably linked to said heterologous transcriptional control sequence, wherein said heterologous transcriptional control sequence is a promoter.

515. The one or more nucleic acids of claim 509, wherein one nucleic acid encodes both the targeter-RNA and the activator-RNA.

516. The one or more nucleic acids of claim 509, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 10 to 15 base pairs.

517. The one or more nucleic acids of claim 509, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 10 base pairs.

518. The one or more nucleic acids of claim 509, wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 20 nucleotides (nt) long.

519. The one or more nucleic acids of claim 509, wherein the target DNA molecule is chromosomal DNA.

520. The one or more nucleic acids of claim 509, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:

441).

521. The one or more nucleic acids of claim 509, wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence

522. A composition comprising:

(1) a Cas9 polypeptide, or a nucleic acid encoding the Cas9 polypeptide; and

(2) a non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises;

(a) a targeter-RNA comprising;

(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and (ii) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and

(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

523. The composition of claim 522, wherein the composition is present as a therapeutic formulation for administration to an animal or human.

524. The composition of claim 522, wherein the Cas9 polypeptide is fused to heterologous polypeptide.

525. The composition of claim 524, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

526. The composition of claim 524, wherein the heterologous polypeptide is a protein tag.

527. The composition of claim 526, wherein the protein tag is a fluorescent protein.

528. The composition of claim 522, wherein the Cas9 polypeptide, or the nucleic acid encoding the Cas9 polypeptide, is conjugated to a protein transduction domain (PTD).

529. The composition of claim 522, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

530. A kit comprising:

(1) a Cas9 polypeptide, or a nucleic acid encoding the Cas9 polypeptide; and

(2) a non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises;

(a) a targeter-RNA comprising;

(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and (ii) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and wherein (1) and (2) are in the same or separate containers.

531. The kit of claim 530, wherein at least one of (1) and (2) is formulated for administration to an animal or human.

532. The kit of claim 530, wherein the Cas9 protein is fused to a heterologous polypeptide.

533. The kit of claim 532, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

534. The kit of claim 532, wherein the heterologous polypeptide is a protein tag.

535. The kit of claim 534, wherein the protein tag is a fluorescent protein.

536. The kit of claim 530, wherein the Cas9 polypeptide, or the nucleic acid encoding the Cas9 polypeptide, is conjugated to a protein transduction domain (PTD).

537. The composition of claim 530, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.