DNA Transfer vector and transformed microorganism containing human proinsulin and pre-proinsulin genes
First Claim
1. A DNA transfer vector comprising an inserted cDNA consisting essentially of a deoxynucleotide sequence coding for human pre-proinsulin, the plus strand of said cDNA having a defined 5'"'"' end, said 5'"'"' end being the first deoxynucleotide of the sequence coding for said pre-proinsulin.
0 Assignments
0 Petitions
Accused Products
Abstract
A DNA having a base sequence coding for human proinsulin and a DNA having a base sequence coding for human pre-proinsulin have been cloned, and novel recombinant DNA transfer vectors containing said cloned DNAs have been constructed. Novel microorganisms transformed by said recombinant transfer vectors have been obtained. Certain of said transformed microorganisms have demonstrated capability to express the cloned DNA'"'"'s, synthesizing a protein comprising human proinsulin and a protein-comprising human pre-proinsulin.
-
Citations
15 Claims
- 1. A DNA transfer vector comprising an inserted cDNA consisting essentially of a deoxynucleotide sequence coding for human pre-proinsulin, the plus strand of said cDNA having a defined 5'"'"' end, said 5'"'"' end being the first deoxynucleotide of the sequence coding for said pre-proinsulin.
-
2. A DNA transfer vector comprising an inserted cDNA consisting essentially of a deoxynucleotide sequence coding for human proinsulin, the plus strand of said cDNA having a defined 5'"'"' end, said 5'"'"' end being the first deoxynucleotide of the sequence coding for said proinsulin.
-
4. A DNA transfer vector comprising a deoxynucleotide sequence coding for human pre-proinsulin consisting essentially of a plus strand having the sequence:
-
5'"'"'--24 GCL-23 X-22 TY-22 TGG-21 ATG-20 W-19 GZ-19 X-18 TY-18 X-17 TY-17 CCL-16 X-15 TY-15 X-14 TY-14 GCL-13 X-12 TY-12 X-11 TY-11 GCL-10 X-9 TY-9 TGG-8 GGL-7 CCL-6 GAK-5 CCL-4 GCL-3 GCL-2 GCL-1 TTK1 GTL2 AAK3 CAJ4 CAK5 X6 TY6 TGK7 GGL8 QR9 S9 CAK10 X11 TY11 GTL12 GAJ13 GCL14 X15 TY15 TAK16 X17 TY17 GTL18 TGK19 GCL20 GAJ21 W22 GZ22 GCL23 TTK24 TTK25 TAK26 ACL27 CCL28 AAJ29 ACL30 W31 GZ31 W32 GZ32 GAJ33 GCL34 GAJ35 GAK36 X37 TY37 CAJ38 GTL39 GGL.sub. 40 CAJ41 GTL42 GAJ43 X44 TY44 GGL45 GGL46 GGL47 CCL48 GGL49 GCL50 GGL51 QR52 S52 X53 TY53 CAJ54 CCL55 X56 TY56 GCL57 X58 TY58 GAJ59 GGL60 QR61 S61 X62 TY62 CAJ63 AAJ64 W65 GZ65 GGL66 ATM67 GTL68 GAJ69 CAJ70 TGK71 TGK72 ACL73 QR74 S74 ATM75 TGK76 QR77 S77 X78 TY78 TAK79 CAJ80 X81 TY81 GAJ82 AAK83 TAK84 TGK85 AAK86 TAGACGCAGCCCGCAGGCAGCCCCCCACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC poly A-3'"'"' wherein A is deoxyadenyl, G is deoxyguanyl, C is deoxycytosyl, T is thymidyl, J is A or G; K is T or C; L is A, T, C, or G; M is A, C or T; Xn is T or C if Yn is A or G; and
C if Yn is C or T;Yn is A, G, C or T if Xn is C, and A or G if Xn is T; Wn is C or A if Zn is G or A, and C if Zn is C or T; Zn is A, G, C or T if Wn is C, and A or G if Wn is A; QRn is TC if Sn is A, G, C or T, and AG if Sn is T or C; Sn is A, G, C or T if QRn is TC, and T or C if QRn is AG; and
, subscript numerals, n, refer to the position in the amino acid sequence of human proinsulin, to which each triplet in the nucleotide sequence corresponds, according to the genetic code, the amino acid positions being numbered from the amino end. - View Dependent Claims (6, 12)
-
-
5. A DNA transfer vector comprising a deoxynucleotide sequence coding for human proinsulin consisting essentially of a plus strand having the sequence:
-
5'"'"'-TTK1 GTL2 AAK3 CAJ4 CAK5 X6 TY6 TGK7 GGL8 QR9 S9 CAK10 X11 TY11 GTL12 GAJ13 GCL14 X15 TY15 TAK16 X17 TY17 GTL18 TGK19 GCL20 GAJ21 W22 GZ22 GCL23 TTK24 TTK25 TAK26 ACL27 CCL28 AAJ29 ACL30 W31 GZ31 W32 GZ32 GAJ33 GCL34 GAJ35 GAK36 X37 TY37 CAJ38 GTL39 GGL40 CAJ41 GTL42 GAJ43 X44 TY44 GGL45 GGL46 GGL47 CCL48 GGL49 GCL50 GGL51 QR52 S52 X53 TY53 CAJ54 CCL55 X56 TY56 GCL57 X58 TY58 GAJ59 GGL60 QR61 S61 X62 TY62 CAJ63 AAJ64 W65 GZ65 GGL66 ATM67 GTL68 GAJ69 CAJ70 TGK71 TGK72 ACL73 QR74 S74 ATM75 TGK76 QR77 S77 X78 TY78 TAK79 CAJ80 X81 TY81 GAJ82 AAK83 TAK84 TGK85 AAK86 TAG-3'"'"' wherein A is deoxyadenyl, G is deoxyguanyl, C is deoxycytosyl, T is thymidyl, J is A or G; K is T or C; L is A, T, C, or G; M is A, C or T; Xn is T or C if Yn is A or G; and
C if Yn is C or T;Yn is A, G, C or T if Xn is C, and A or G if Xn is T; Wn is C or A if Zn is G or A, and C if Zn is C or T; Zn is A, G, C or T if Wn is C, and A or G if Wn is A; QRn is TC if Sn is A, G, C or T, and AG if Sn is T or C; Sn is A, G, C or T if QRn is TC, and T or C if QRn is AG; and
, subscript numerals, n, refer to the position in the amino acid sequence of human proinsulin, to which each triplet in the nucleotide sequence corresponds, according to the genetic code, the amino acid positions being numbered from the amino end. - View Dependent Claims (13, 14)
-
- 7. The plasmid pcHI-1.
-
8. The plasmid pcHP-1.
-
15. 45, 47, 51, 55, 57, 66 and 73;
-
L is G in amino acid positions 18, 20, 39, 40, 42, 46, 60 and 68; M is C in amino acid position 75; M is T in amino acid position 67; X is T in amino acid position 56; X is C in amino acid positions 6, 11, 15, 17, 37, 53, 58, 62, 78, and 81; X is G in amino acid position 44; Y is A in amino acid position 17; Y is G in amino acid positions 37, 44, 53, 56, 58, 62, and 81; Y is C in amino acid positions 11, 15 and 78; Y is T in amino acid position 6; W is C in amino acid positions 22, 31, 32 and 65; Z is A in amino acid position 22; Z is G in amino acid positions 31 and 32; Z is T in amino acid position 65; QR is TC in amino acid positions 9, 62 and 77; QR is AG in amino acid positions 52 and 74 S is T in amino acid position 9; and S is C in amino acid positions 52, 61, 74 and 77.
-
Specification