Nucleic acid probes of human papilloma virus

• US 4,983,728 A
• Filed: 07/28/1988
• Issued: 01/08/1991
• Est. Priority Date: 07/31/1987
• Status: Expired due to Term

• Current Assignee: La Region Wallone
• Original Assignee: IRE-Celltarg S.A.
• Inventors: Herzog, Albert, Houard, Sophie, Bollen, Alex, Cravador, Alfredo
• Primary Examiner(s): Yarbrough, Amelia Burgess
• Assistant Examiner(s): MARSCHEL, ARDIN H
• Application Number:
  US07/225,381
• Time in Patent Office: 894 Days
• Field of Search: 435/6, 435/91, 435/948, 436/501, 436/811, 536/27, 935/9, 935/16, 935/17, 935/78, 935/88
• US Class Current: 435/5
• CPC Class Codes: C12Q 1/708 for papilloma
• CPC Class Codes: Y10S 435/948 using viruses or cell lines
• CPC Class Codes: Y10S 436/811 Test for named disease, body condition or organ function

Abstract

The present invention relates to probes of nucleic acids useful for detecting indifferently the various types of human papilloma virus, particularly HPV1a, HPV5, HPV6b, HPV8, HPV11, HPV16, HPV18 and HPV33, especially a probe comprising a labelled sequence of nucleic acids, characterized in that it comprises the oligomer of twelve nucleotides X-A-A-A-A-C-G-A-A-A-G-X, with X=T or U, or its complement by interchanging A and X on the one hand, C and G on the other hand. The present invention also relates to specific probes of nucleic acids for the detection of human papilloma for each of the types HPV1a, HPV5, HPV8, HPV11, HPV16, HPV18 and HPV33, as well as specific probes of sub-groups of the virus HPV16, HPV18, HPV33 or HPV16 and HPV18 only or again HPV5 and HPV8 only.

Claims

1. Nucleic acid probe useful for detecting indifferently eight types of human papilloma virus, HPV1a, HPV5, HPV6b HPV8, HPV11, HPV16, HPV18 and HPV33, consisting of a sequence of labelled nucleic acids, said probe consisting essentially of a mixture of oligomers, which include a sequence of 12 nucleotides X-A-A-A-A-C-G-A-A-A-G-X with X=T or U, or its complement extended on each side by 1 to 10 corresponding nucleotides for each of the eight virus types.

15. Probe of nucleic acids according to claim 1, said probe being labelled by one of the methods known for the labelling of DNA or RNA probes, selected particularly from among radioactive labelling, such as 32p and enzymatic labelling, such as with biotin.

16. Method for detecting a type of HPV virus or of a sub-group of HPV virus by means of a probe, according to claim 1, said method comprising hybridizing said probe with a DNA or RNA sequence of said HPV virus, as the case may be, previously denaturated if it was initially double-stranded.

17. Method of detection according to claim 16, consisting essentially of using the PCR method of amplification with following oligomeric primers:

space="preserve" listing-type="tabular">______________________________________ length of amplified position fragment ______________________________________ for HPV1a GTTGCTTCCTGTGCCTATTGCG 673-694 90 CAGAAGGAGTTCCTCCAGCTG 762-742 for HPV5 ATTATTCTGGAGCTCAGTGAGGT 693-715 252 ACAGTCAGGGCACAGGAGCTGC 944-922 for HPV6B TGTATTAGACCTGCAACCTCCAG 562-584 224 TTCCCAACAGAAGCTGTTGCAC 785-764 for HPV8 CTAGACATCGAAAGAACTGTATTC 779-802 156 GCACTCAGGACACAGAAGCTGT 934-913 for HPV33 GGCTTGGACCGGCCAGATGG 681-700 178 GTGCACAGGTAGGGCACACAA 858-838 ______________________________________

2. Nucleic acid probe common to the eight different types of HPV virus, HPV1a, HPV5, HPV6b, HPV8, HPV11, HPV16, HPV18 and HPV33, said probe consisting essentially of a mixture of six oligomers, which include a common sequence of twelve nucleotides X-A-A-A-A-C-G-A-A-A-G-X and with X=T or U, or its complement extended on each side by 1 to 10 corresponding nucleotides for each of the eight virus types.

3. Probe according to claim 2, wherein the mixture of the six oligomers are:

for HPV1a A-X-G-C-X-X-X-A-A-A-A-C-G-A-A-A-G-X-X-A-C-X-X-X

for HPV6b and HPV11 A-G-G-A-C-C-X-A-A-A-A-C-G-A-A-A-G-X-A-X-X-X-A-G

for HPV8 and HPV5 C-A-A-A-A-A-C-X-A-A-A-A-C-G-A-A-A-G-X-A-X-C-X-X-A

for HPV16 A-G-G-X-X-C-X-A-A-A-A-C-G-A-A-A-G-X-A-X-X-X-G-G

for HPV18 A-X-G-X-X-X-X-A-A-A-A-C-G-A-A-A-G-X-X-X-G-C-A-G

for HPV33 G-X-G-C-A-C-X-A-A-A-A-C-G-A-A-A-G-X-X-X-G-C-C-G

with X=T or U or their complements.

4. Specific probe of nucleic acids for the detection of the HPV1a type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

CCXCAGGCGAGAAGCGCGGAC

CXGXCCCXXCXGCGCGAGACGX

XGXCCCXXCXGCGCGAGACGXXGGAAGXAXACACA

GACCGXCCXCGCGGAXCACAG

GACCGXCCXCGCGGAXCACAGCGCCAXXAGACAGC

with X=T or U and their complements.

5. Specific nucleic acid probe for the detection of the HPV5 type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

XGXAXGGGAXCGGGGGCGXXXA

XXGXAXGGGAXCGGGGGCGXXXA

XGXAXGGGAXCGGGGGCGXXXAGCCAXGGACCAXA

GCCXGACAACGAAAGGAXCXCXXA

GAGGAGCCXGACAACGAAAGGAXCXCXXACAAAGX

with X=T or U and their complements.

6. Specific probe of nucleic acids for the detection of the HPV6b type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

CAXXAACGCAGGGGCGCCXGAA

GGCAAXCAXXAACGCAGGGGCG

GCAAXCAXXAACGCAGGGGCGCCXGAAAXXGXGCC

GACGAAGXGGACGGACAAGAXXC

GAGGXGGACGAAGXGGACGGACAAGAXXCACAACC

with X=T or U and their complements.

7. Specific probe of nucleic acids for the detection of the HPV8 type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

ACACCGCCGCCAAGACCCCCA

GCAGCXCAGXCCGCGGCXCC

GCAGCXCAGXCCGCGGCXCCAGXCAAXAXCACXGX

XGXCAACGCAACXGAXXCGGGXAX

CXXXXXGXCAACGCAACXGAXXCGGGXAXCAGGAC

with X=T or U and their complements.

8. Specific probe of nucleic acids for the detection of the HPV11 type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

GGCGXGXCGGCGCCGCCXAG

GAAGCXCXCCCAAGCCXGCXAXX

XAXAXACCCXXGGGAAGCXCXCCCAAGCCXGCXAX

XGAGGXGGACAAGGXGGACAAAC

AGAAGAXGAGGXGGACAAGGXGGACAAACAAGACG

with X=T or U and their complements.

9. Specific probe of nucleic acids for the detection of the HPV16 type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

CAGAACCGGACAGAGCCCAX

ACCAGAGACAACXGAXCXCXACXGX

and ACAAGCAGAACCGGACAGAGCCCA

XGXXAGAXXXGCAACCAGAGACAACXGAXCXCXAC

AGXGXGACXCXACGCXXCGGXXG

XXGCAAGXGXGACXCXACGCXXCGGXXGXGCGXAC

with X=T or U and their complements.

10. Specific probe of nucleic acids for the detection of the HPV18 type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

CGGXAXCCGCXACXCAGCXXG

CCCAXXGXAXCACCCACGGCCC

CCCAXXGXAXCACCCACGGCCCCXGCCXCXACACA

XXGXAAGXGXGAAGCCAGAAXXGAG

AXGXGXXGXAAGXGXGAAGCCAGAAXXGAGCXAGX

with X=T or U and their complements.

11. Specific probe of nucleic acids for the detection of the HPV33 type of human papilloma virus, said probe consisting essentially of an oligomer selected from among:

CGXCCXCCGGXXACXGXAGAXA

GXCCXCCGGXXACXGXAGACACX

XCCXCCGGXXACXGXAGACACXGXXGGACCXXXAG

AGCAAGXGACCXACGAACCAXACA

AGXACAGCAAGXGACCXACGAACCAXACAGCAACX

with X=T or U and their complements.

12. Specific probe of nucleic acids of the subgroup of HPV virus constituted by HPV16, HPV18 and HPV33, said probe consisting essentially of the oligomer

XXAGGCACAXAXXXX

with X=T or U or its complement.

13. Specific probe of nucleic acids of the subgroup of HPV virus constituted by HPV16 and HPV 18, said probe consisting essentially of the oligomer

AXAXCAAAXAXXAGXGAAGX

with X=T or U or its complement.

14. Specific probe of nucleic acids of the subgroup of HPV virus constituted by HPV5 and HPV8, said probe consisting essentially of the oligomer

CAAACAACAGXXGCXGACAAXAXXXXAAAAXAXGGCAGXGCXGGXGXAXXX

XXXGG

with X=T or U or its complement or a fragment of the latter comprising between 18 and 35 oligomers such as

XAXGGCAGXGCXGGXGXAXXXXXXG

with X=T or U or its complement.