Prenatal sex determination of bovine cells using male-specific oligonucleotides

• US 5,055,393 A
• Filed: 06/13/1989
• Issued: 10/08/1991
• Est. Priority Date: 06/13/1989
• Status: Expired due to Fees

• Current Assignee: Merck & Co., Inc.
• Original Assignee: The SALK Institute Biotechnology/Industrial Associates Incorporated
• Inventors: Gingeras, Thomas R., Kwoh, Deborah Y.
• Primary Examiner(s): Wax, Robert A.
• Assistant Examiner(s): Steffe, Eric
• Application Number:
  US07/366,153
• Time in Patent Office: 847 Days
• Field of Search: 435/6, 435/172.3, 435/91, 536/26, 536/27, 536/28, 436/501, 436/94, 935/77, 935/78
• US Class Current: 435/6.11
• CPC Class Codes: C12Q 1/686 Polymerase chain reaction [PCR]
• CPC Class Codes: C12Q 1/6879 for sex determination
• CPC Class Codes: Y10T 436/143333 Saccharide [e.g., DNA, etc.]

Abstract

Compositions and methods are provided for determining the sex of Bovine embryos and fetuses employing male-specific oligonucleotides in nucleic acid probe hybridization assay methods to assay the genomic DNA of embryonic or fetal cells for the presence of male-specific sequences.

Claims

1. An oligonucleotide having or containing substantially the same sequence as that of a DNA selected from the group consisting of

CCTTGCACAGTCGCTAGGGCACA,

ATCCAGGCTGGCTCCTGCCCTCGGTCAAGA and

GTTCCGCCCTTCCTGAAGTGCCCGTCTAAA.

2. An oligonucleotide according to claim 1 which is labeled with a detectable marker.

3. An oligonucleotide according to claim 2 wherein said detectable marker is selected from the group consisting of ³ H, ³² P, alkaline phosphatase and biotin.

4. An oligonucleotide according to claim 3 wherein said detectable marker is alkaline phosphatase.

5. A method for determining the sex of an embryo or fetus of a species of genus Bos, comprising:

(a) contacting chromosomal DNA extracted from at least 100 cells of said embryo or fetus under hybridization conditions with one or more hybridization probes labeled with a detectable market, at least one of said probes having or containing substantially the same sequence as that of a male-specific DNA selected from the group consisting of

space="preserve" listing-type="equation">CCTTGCACAGTCGCTAGGGCACA,

space="preserve" listing-type="equation">ATCCAGGCTGGCTCCTGCCCTCGGTCAAGA and

space="preserve" listing-type="equation">GTTCCGCCCTTCCTGAAGTGCCCGTCTAAA,

and

(b) ascertaining whether hybridization above background occurs between said chromosomal DNA and said male-specific occurs between said chromosomal DNA and said male-specific hybridization probe or probes.

6. A method according to claim 5, wherein said detectable marker is selected from the group consisting of ³ H, ³² P, alkaline phosphatase and biotin.

7. A method according to claim 6 wherein said detectable marker is alkaline phosphatase.

8. A method for determining the sex of an embryo or fetus of a species of genus Bos, comprising:

(a) amplifying a male specific segment of chromosomal DNA of said embryo or fetus, by

(i) separating complementary strands of said chromosomal DNA,

(ii) annealing the separated complementary strands, respectively with a 5'"'"' and 3'"'"' oligonucleotide primer pair having sufficient homology with said strand of male-specific segment of said chromosomal DNA to hybridize therewith,

(iii) incubating the annealed DNA with DNA polymerase whereby the 5'"'"' and 3'"'"' oligonucleotide primers are extended through said male-specific segment of said chromosomal DNA, if present, and repeating steps (a) (i)-(iii) as many times as required to obtain a desired level of said double-stranded male-specific segment of said chromosomal DNA, and

(b) detecting the amplified, double-stranded male-specific segment in said chromosomal DNA by

(i) contacting said chromosomal DNA under hybridization conditions with a hybridization probe labeled with a detectable marker, and

(ii) ascertaining whether hybridization above background occurs between said chromosomal DNA of the embryo or fetus and the hybridization probe, wherein said 5'"'"' and 3'"'"' oligonucleotide pair and said hybridization probe have or contain substantially the same sequences as those of the DNAs selected from the group consisting of

(A) a 5'"'"' primer of sequence

space="preserve" listing-type="equation">CACAGTCGCCAGGGCACAGGGCTG

a 3'"'"' primer of sequence

space="preserve" listing-type="equation">AGCCCTGTGCTCTGGCGACTGTGAAACC

a detection oligonucleotide of sequence

space="preserve" listing-type="equation">CCTTGCACAGTCGCTAGGGCACA,

(B) a 5'"'"' primer of sequence

space="preserve" listing-type="equation">AAGACCCTGACAAACACTCCTGAGCCCACC

a 3'"'"' primer of sequence

space="preserve" listing-type="equation">GCCTGCTTCGGTGCAGGGATCCGGAGTGGG

a detection oligonucleotide of sequence

space="preserve" listing-type="equation">ATCCAGGCTGGCTCCTGCCCTCGGTCAAGA,

(C) a 5'"'"' primer of sequence

space="preserve" listing-type="equation">CCTCCCCTTGTTCAAACGCCCGGAATCATT

a 3'"'"' primer of sequence

space="preserve" listing-type="equation">TGCTTGACTGCAGGGACCGAGAGGTTTGGG

a detection oligonucleotide of sequence

space="preserve" listing-type="equation">GTTCCGCCCTTCCTGAAGTGCCCGTCTAAA.

9. A method according to claim 8, wherein in step (a) a non-sex-specific DNA segment is also coamplified, using non-sex-specific 5'"'"' and 3'"'"' primers and a detection oligonucleotide selected from the group consisting of

(D) a 5'"'"' primer of sequence

10. A method according to claim 8, wherein said detectable marker is selected from the group consisting of ³ H, ³² P, alkaline phosphatase and biotin.

11. A method according to claim 10 wherein said detectable marker is alkaline phosphatase.