Chimeric messenger RNA detection methods

• US 5,057,410 A
• Filed: 08/05/1988
• Issued: 10/15/1991
• Est. Priority Date: 08/05/1988
• Status: Expired due to Term

• Current Assignee: Roche Molecular Systems (Roche Holding AG)
• Original Assignee: Cetus Corporation (Bayer AG)
• Inventors: Witto, Owen O., McCormick, Francis P., Kawasaki, Ernest S.
• Primary Examiner(s): Wax, Robert A.
• Assistant Examiner(s): Fleisher, Mindy B.
• Application Number:
  US07/229,604
• Time in Patent Office: 1,166 Days
• Field of Search: 435/6, 536/27, 935/77, 935/78
• US Class Current: 435/6.11
• CPC Class Codes: C12Q 1/6886 for cancer immunoassay for cancer G01N33/574
• CPC Class Codes: C12Q 2600/112 Disease subtyping, staging or classification
• CPC Class Codes: C12Q 2600/158 Expression markers

Abstract

The invention provides highly sensitive methods for detecting specific sequences contained in chimeric mRNA. The mRNA sequences are reverse transcribed into complementary DNA (cDNA), amplified by the Polymerase Chain Reaction, and detected by hybridization with a labeled sequence specific oligonucleotide probe. The method is particularly valuable for the detection of chimeric mRNAs experessed by activated oncogenes that result from aberrant genetic rearragements such as chromosomal translocations.

Claims

1. A method for detecting a chimeric mRNA in a biological sample, wherein said chimeric mRNA is associated with acute lymphocytic leukemia (ALL) and comprises a BCR exon in junction with an ABL exon, the method has the step of:

a) synthesizing cDNA from mRNA in said sample;

b) contacting said cDNA with a first and second primer, wherein said first primer is homologous to a sequence contained in said BCR exon and said second primer is complementary to a sequence in said ABL exon to provide a mixture for amplifying chimeric mRNA associated with ALL;

c) treating the mixture prepared in step (b) under conditions and with reagents suitable for amplifying said cDNA segment by a polymerase chain reaction; and

d) determining if amplification has occurred.

2. The method of claim 1 wherein said determining step comprises contacting the mixture prepared in step (c) with an oligonucleotide probe under hybridizing conditions and determining whether hybridization has occurred, wherein said probe is selected from the group consisting of a probe having a sequence that is homologous to said chimeric mRNA sequence contained in said cDNA and a probe having a sequence that is complementary to said chimeric mRNA sequence contained in said cDNA.

3. The method of claim 2, wherein said probe for detecting chimeric mRNA associated with acute lymphocytic leukemia consists essentially of the sequence:

5'"'"'-GCTGAAGGGTTCTGCGTCTCCAT-3'"'"'.

4. The method of claim 1 wherein said first primer has the sequence:

space="preserve" listing-type="equation">5'"'"'CGCATGTTCCGGGACAAAAGC3'"'"',

and said second primer has the sequence;

space="preserve" listing-type="equation">5'"'"'GGTCATTTTCACTGGGTCCAGC3'"'"'.

5. A method for detecting a chimeric mRNA in a biological sample, wherein said chimeric mRNA is associated with chronic myeloid leukemia (CML) and comprises a BCR exon in junction with an ABL exon, the method has the steps of:

a) synthesizing cDNA from mRNA in said sample;

b) contacting said cDNA with a first and second primer, wherein said first primer has the sequence;

space="preserve" listing-type="equation">5'"'"'GGAGCTGCAGATGCTGACCAAC3'"'"',

and said second primer has the sequence;

space="preserve" listing-type="equation">5'"'"'TCAGACCCTGAGGCTCAAAGTC3'"'"',

to provide a mixture for amplifying chimeric mRNA associated with CML;

c) treating the mixture prepared in step (b) under conditions and with reagents suitable for amplifying said cDNA segment by a polymerase chain reaction; and

d) determining if amplification has occurred.

6. The method of claim 5, wherein said determining step comprises contacting the mixture prepared in step (c) with an oligonucleotide probe, and said oligonucleotide probe has the sequence:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTCTTCCTTATTGATG3'"'"'.

7. The method of claim 5 wherein said determining step comprises contacting the mixture prepared in step (c) with an oligonucleotide probe, and said oligonucleotide probe has the sequence:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTTTGAACTCTGCTTA3'"'"'.

8. A method for distinguishing between chimeric mRNA associated with chronic myeloid leukemia (CML) and chimeric mRNA associated with acute lymphocytic leukemia (ALL), in a biological sample, wherein said chimeric mRNAs each comprise a BCR exon in junction with an ABL exon, the method has the steps of:

a) synthesizing cDNA from mRNA in said sample;

b) contacting said cDNA with a first and second primer for amplifying chimeric mRNA associated with CML that contains an exon-junction between a BCR exon and an ABL exon;

c) treating the mixture prepared in step (b) under conditions and with reagents suitable for amplifying said cDNA segment by a polymerase chain reaction; and

d) contacting said cDNA of step (a) with a third and fourth primer, for amplifying chimeric mRNA associated with ALL that contains an exon-junction between a BCR exon and an ABL exon;

e) treating the mixture prepared in step (d) under conditions and with reagents suitable for amplifying said cDNA segment by a polymerase chain reaction; and

f) determining if amplification has occurred in each of step (c) and step (e).

9. The method claim 8, wherein said determining step (f) comprises:

(1) contacting the mixture prepared in step (c) with an oligonucleotide probe specific for an exon-junction between a BCR exon and an ABL exon contained within chimeric mRNA associated with chronic myeloid leukemia; and

(2) contacting the mixture prepared in step (e) with an oligonucleotide probe specific for an exon-junction between a BCR exon and an ABL exon contained within chimeric mRNA associated with acute lymphocytic leukemia.

10. The method of claim 8, wherein said first primer has the sequence:

space="preserve" listing-type="equation">5'"'"'GGAGCTGCAGATGCTGACCAAC3'"'"';

said second primer has the sequence;

space="preserve" listing-type="equation">5'"'"'TCAGACCCTGAGGCTCAAAGTC3'"'"';

said third primer has the sequence;

space="preserve" listing-type="equation">5'"'"'CGCATGTTCCGGGACAAAAGC3'"'"';

and said fourth primer has the sequence;

space="preserve" listing-type="equation">5'"'"'GGTCATTTTCACTGGGTCCAGC3'"'"'.

11. The method of claim 9, wherein at step (f) (1) said probe comprises a sequence selected from the group of nucleic acid sequences consisting of:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTTTGAACTCTGCTTA3'"'"';

space="preserve" listing-type="equation">and

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTCTTCCTTATTGATG3'"'"'.

12. The method of claim 9, wherein at step (f) (2) said probe comprises the sequence:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTCTGCGTCTCCAT3'"'"'.

13. A kit for detecting a chimeric mRNA associated with chronic myeloid leukemia (CML), wherein said chimeric mRNA comprises a BCR exon in junction with an ABL exon, said kit comprising:

a) a first and second primer wherein said first primer has the sequence;

space="preserve" listing-type="equation">5'"'"'GGAGCTGCAGATGCTGACCAAC3'"'"',

and said second primer has the sequence;

space="preserve" listing-type="equation">5'"'"'TCAGACCCTGAGGCTCAAAGTC3'"'"',

b) an oligonucleotide probe.

14. The kit of claim 13 wherein said oligonucleotide probe has the sequence:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTCTTCCTTATTGATG3'"'"'.

15. The kit of claim 13 wherein said oligonucleotide probe has the sequence:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTTTGAACTCTGCTTA3'"'"'.

16. A kit for detecting a chimeric mRNA associated with acute lymphocytic leukemia, wherein said chimeric mRNA comprises a BCR exon in junction with an ABL exon, said kit comprising:

a) a first and second primer where said first primer is homologous to a sequence contained in said BCR exon and said second primer is complementary to a sequence in said ABL exon; and

b) an oligonucleotide probe specific for the exon junction between said BCR exon and said ABL exon.

17. The kit of claim 16 wherein said first primer has the sequence:

space="preserve" listing-type="equation">5'"'"'CGCATGTTCCGGGACAAAAGC3'"'"',

said second primer has the sequence;

space="preserve" listing-type="equation">5'"'"'GGTCATTTTCACTGGGTCCAGC3'"'"',

and said oligonucleotide probe has the sequence;

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTCTGCGTCTCCAT3'"'"'.

18. The kit of claim 16 that further comprises reagents for polymerase chain reaction.

19. A kit for distinguishing between chimeric mRNA associated with chronic myeloid leukemia (CML) and chimeric mRNA associated with acute lymphocytic leukemia (ALL), in a biological sample, wherein said chimeric mRNAs each comprise a BCR exon in junction with an ABL exon, said kit comprising:

a) a first and second primer for amplifying chimeric mRNA associated with CML which contains an exon-junction between a BCR exon and an ABL exon;

b) a third and fourth primer for amplifying chimeric mRNA associated with ALL which contains an exon-junction between a BCR exon and an ABL exon;

c) a first oligonucleotide probe specific for said chimeric mRNA associated with CML; and

d) a second oligonucleotide probe specific for said chimeric mRNA associated with ALL.

20. The kit of claim 19, wherein said first primer is

21. The kit of claim 19 that further comprises reagents for carrying out polymerase chain reaction.

22. The kit of claim 19, wherein said first probe has the sequence:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTTTGAACTCTGCTTA3'"'"';

and said second probe has the sequence;

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTCTGCGTCTCCAT3'"'"'.

23. The kit of claim 19 that further comprises a third oligonucleotide probe, wherein said third probe is distinct from said first oligonucleotide probe and is specific for said chimeric mRNA associated with chronic myeloid leukemia.

24. The kit of claim 23 wherein said third probe has the sequence:

space="preserve" listing-type="equation">5'"'"'GCTGAAGGGCTTCTTCCTTATTGATG3'"'"'.