Process for conducting site-directed mutagenesis

• US 5,071,743 A
• Filed: 10/27/1989
• Issued: 12/10/1991
• Est. Priority Date: 10/27/1989
• Status: Expired due to Fees

• Current Assignee: Majesty In Right of Canada As Represented By The National Research Council of Canada
• Original Assignee: Her Majesty The Queen In Right of Canada As Represented By The Minister of Industry (The Republic of Canada)
• Inventors: Shen, Shi-hsiang, Lebel, Susan, Slilaty, Steve N.
• Primary Examiner(s): Wax, Robert A.
• Assistant Examiner(s): BICKEL, MINDY B
• Application Number:
  US07/427,703
• Time in Patent Office: 774 Days
• Field of Search: 435/6, 536/27, 935/77, 935/78
• US Class Current: 435/6.18
• CPC Class Codes: C12N 15/102 Mutagenizing nucleic acids
• CPC Class Codes: C12N 9/2471 Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
• CPC Class Codes: C12Y 302/01023 Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase

Abstract

The present invention relates to an approach for conducting site-directed mutagenesis using double-stranded DNA templates. The approach involves the development of a method for generating structures capable of directing full-length complementary-strand synthesis from double-stranded plasmid DNA. These structures are formed following heat denaturation and cooling of linearized plasmid DNA molecules in the presence of what is referred to as a "closing oligonucleotide". A "closing oligonucleotide" is a single-stranded oligonucleotide consisting of a sequence complementary to either or both free ends of one of the two plasmid DNA strands. The "closing oligonucleotide" therefore functions as an agent for recircularization of a DNA strand and generation of a primer-circular template structure suitable for polymerase-dependent full-length complementary-strand synthesis and ligation into a covalently-closed heteroduplex DNA molecule. When combined with a mutagenic oligonucleotide and uracil-substituted DNA templates, this approach allows site-directed mutagenesis to be performed directly on double-stranded DNA with a mutant formation efficiency of about 50%, a level amenable to rapid screening by DNA sequencing.

Claims

1. A process for conducting site-directed mutagenesis on double-stranded DNA previously cleaved and denatured to single-stranded linear DNA templates, said process comprising

(a) hybridizing mutagenic and closing oligonucleotides to single-stranded linear DNA templates, said closing oligonucleotide being characterized by having a nucleotide sequence complementary to one or both of the free ends of said linear DNA templates, and functioning to circularize said linear DNA templates and generate a primer-circular template structure suitable for polymerase-dependent full-length complementary-strand synthesis and ligation into a covalently-closed heteroduplex DNA molecule,

(b) incorporating said mutagenic and closing oligonucleotides into DNA strands complementary to said linear DNA templates by submitting said hybridized linear DNA templates to the action of polymerase and ligase enzymes to yield heteroduplex double-stranded DNA molecules, and

(c) selectively replicating said complementary DNA strands of said heteroduplex double-stranded DNA.

2. A process according to claim 1, which further comprises an initial step through which said double-stranded DNA is cleaved and denatured to yield single-stranded linear DNA templates.

3. A process according to claim 1, wherein said double-stranded DNA is a plasmid or any autonomous replicon.

4. A process according to claim 1, wherein said closing oligonucleotide has a nucleotide sequence complementary to the free ends of said linear DNA templates to anneal to both free ends of said linear DNA templates upon hybridization to cause circularization of said linear DNA templates.

5. A process according to claim 1, wherein said closing oligonucleotide has a sequence complementary to the 3'"'"' end of said linear DNA templates thereby creating blunt-ended molecules upon hybridization to said linear DNA templates.

6. A process according to claim 1, wherein said complementary DNA strands are selectively replicated by initially propagating said double-stranded DNA in a dut^- ung^- bacterial strain to obtain uracil-substituted DNA templates and then transforming said heteroduplex DNA molecules into a dut⁺ ung⁺ bacterial strain to obtain the desired mutant molecules.

7. A process according to claim 1, wherein said closing oligonucleotides are selected from the group consisting of the following:

(AatII) 5'"'"'TGGTTTCTTAGACGTCAGGTGGCACTTTTC;

(AflIII) 5'"'"'CTGGCCTTTTGCTCACATGTTCTTTCCTGC;

(AseI) 5'"'"'CTTCCCGGCAACAATTAATAGACTGGATGG;

(MstI) 5'"'"'TGGCAACAACGTTGCGCAAACTATTAACTG;

(NdeI) 5'"'"'GTATTTCACACCGCATATGGTGCACTCTCA;

(PstI) 5'"'"'ACCACGATGCCTGCAGCAATGGCAACAACG;

(PvuI) 5'"'"'ACTTCTGACAACGATCGGAGGACCGAAGGA;

(ScaI) 5'"'"'ATGACTTGGTTGAGTACTCACCAGTCACAG;

(SspI) 5'"'"'AAATGCTTCAATAATATTGAAAAAGGAAGA;

(XmnI) 5'"'"'TCGCCCCGAAGAACGTTTTCCAATGATGAG;

5'"'"'CTGTGACTGGTGAGTACTCAACCAAGTCAT;

and complementary sequences thereof.

8. A kit for conducting site-directed mutagenesis of double-stranded DNA previously cleaved and denatured to single-stranded linear DNA templates, said templates being hybridized to mutagenic and closing oligonucleotides incorporated into DNA strands complementary to said templates, said kit comprising:

(a) one or more closing oligonucleotides having a nucleotide sequence complementary to one or both of the free ends of said linear DNA templates, said oligonucleotide being characterized and functioning to circularize said linear DNA templates and generate a primer-circular template structure suitable for polymerase-dependent full-length complementary-strand synthesis and ligation into a covalently-closed heteroduplex DNA molecule, and

(b) means for selective replication of said complementary DNA strands.

9. A kit according to claim 8, wherein said closing oligonucleotides are selected from the group consisting of the following:

(AatII) 5'"'"'TGGTTTCTTAGACGTCAGGTGGCACTTTTC;

(AflIII) 5'"'"'CTGGCCTTTTGCTCACATGTTCTTTCCTGC;

(AseI) 5'"'"'CTTCCCGGCAACAATTAATAGACTGGATGG;

(MstI) 5'"'"'TGGCAACAACGTTGCGCAAACTATTAACTG;

(NdeI) 5'"'"'GTATTTCACACCGCATATGGTGCACTCTCA;

(PstI) 5'"'"'ACCACGATGCCTGCAGCAATGGCAACAACG;

(PvuI) 5'"'"'ACTTCTGACAACGATCGGAGGACCGAAGGA;

(ScaI) 5'"'"'ATGACTTGGTTGAGTACTCACCAGTCACAG;

(SspI) 5'"'"'AAATGCTTCAATAATATTGAAAAAGGAAGA;

(XmnI) 5'"'"'TCGCCCCGAAGAACGTTTTCCAATGATGAG;

5'"'"'CTGTGACTGGTGAGTACTCAACCAAGTCAT;

and complementary sequences thereof.

10. A kit according to claim 8, wherein said closing oligonucleotides have a nucleotide sequence complementary to the free ends of said linear DNA templates to anneal to both free ends of said linear DNA templates upon hybridization to cause circularization of said linear DNA templates.

11. A kit according to claim 8, wherein said means for selective replication of the mutant plasmid is selected from propagation of said double-stranded DNA in a dut^- ung^- bacterial strain, incorporation of thionucleotides into said complementary DNA strands, or differential methylation.