Use of a bGH gDNA polyadenylation signal in expression of non-bGH polypeptides in higher eukaryotic cells

• US 5,122,458 A
• Filed: 01/11/1989
• Issued: 06/16/1992
• Est. Priority Date: 08/24/1984
• Status: Expired due to Term

• Current Assignee: Research Corporation Technologies
• Original Assignee: The Upjohn Company (Pharmacia Corp.)
• Inventors: Goodwin, Edward C., Palermo, Daniel P., Rottman, Fritz M., Woychik, Richard P., Thomsen, Darrell R., Post, Leonard E.
• Primary Examiner(s): Martinell, James
• Application Number:
  US07/295,967
• Time in Patent Office: 1,252 Days
• Field of Search: 435/172.1, 435/172.3, 435/91, 435/243, 435/240.1, 435/240.2, 435/69.1, 435/69.2, 435/320.1, 536/27, 935/6, 935/10, 935/14, 935/11, 935/32, 935/34, 935/61, 935/70, 935/71
• US Class Current: 435/69.1
• CPC Class Codes: A61B 2017/00004 (bio)absorbable, (bio)resorbable or resorptive
• CPC Class Codes: C12N 15/70 Vectors or expression systems specially adapted for E. coli
• CPC Class Codes: C12N 15/85 for animal cells
• CPC Class Codes: C12N 9/6459 t-plasminogen activator (3.4.21.68), i.e. tPA
• CPC Class Codes: C12Y 304/21069 Protein C activated (3.4.21.69)

Abstract

The present invention relates to the use of the polyadenylation signal from the gene for bovine growth hormone to achieve a high level of expression of peptides in eukaryotic cells. Accordingly, the present invention provides a recombinant DNA compound comprising: a first nucleotide sequence which contains a promoter capable of initiating transcription of a gene; a second nucleotide sequence which encodes a gene for a polypeptide other than bovine growth hormone, including genomic and other intron containing forms thereof; a third nucleotide sequence which contains a bovine growth hormone polyadenylation signal; and a fourth nucleotide sequence which optionally contains a selectable marker. The first, second and third sequences are operably linked in sequence to form a functional genetic unit capable of being expressed. The fourth sequence, which is optionally provided, is useful for determining whether or not the DNA of the present invention has been incorporated into a living cell.

Claims

1. A recombinant DNA molecule comprising:

(a) a DNA sequence that encodes a polypeptide other than bovine growth hormone; and

,

(b) a bovine growth hormone gene polyadenylation signal, said polyadenylation signal comprises the nucleotide sequence;

space="preserve" listing-type="equation">5'"'"'GTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTC 3'"'"';

wherein said DNA sequence that encodes a polypeptide other than bovine growth hormone is upstream from and operably linked to said polyadenylation signal.

2. A recombinant DNA molecule according to claim 1 further comprising a promoter, said promoter is upstream from and operably linked to said DNA sequence that encoders a polypeptide other than ovine growth hormone.

3. A recombinant DNA molecule according to claim 1 further comprising a selectable marker.

4. A recombinant DNA molecule according to claim 2 wherein said promoter is a Cytomegalovirus immediate early promoter.

5. A recombinant DNA molecule according to claim 1 wherein said polyadenylation signal comprises bovine growth hormone genomic DNA nucleotide sequence from the PvuII cleavage site in the condons coding for amino acids 190-192 to the next subsequent EcoRI cleavage site downstream therefrom.

6. A recombinant DNA molecule according to claim 5 wherein said polyadenylation signal comprises bovine growth hormone genomic DNA nucleotide sequence from the PstI cleavage site in the codons coding for amino acids 90-91 to the next subsequent EcoRI cleavage site downstream therefrom including the intron therein.

7. A recombinant DNA molecule according to claim 1 wherein said DNA sequen e that encodes a polypeptide other than obvine growth hormone comprises cDNA encoding tissue plasminogen activator.

8. A method of producing a pre-selected polypeptide which comprises the steps of:

(a) culturing a eukaryotic cell or cell line comprising a recombinant DNA molecule according to claim 2, wherein said DNA sequence that encodes a polypeptide other than bovine growth hormone encodes a pre-selected polypeptide; and

(b) recovering said pre-selected polypeptide.

9. The method according to claim 8 wherein the pre-selected polypeptide is tissue plasminogen activator.

10. A eukaryotic cell or cell line comprising a recombinant DNA molecule according to claim 1 wherein said eukaryotic cell or cell ine expresses said DNA sequence that encodes a polypeptide other than bovine growth hormone.

11. A eukaryltic cell o cell line according to claim 10 wherein said coding sequence is tissue plasminogen activator.