Detection of chlamydia trachomatis by polymerase chain reaction using biotin labelled lina primers and capture probes

• US 5,232,829 A
• Filed: 09/29/1989
• Issued: 08/03/1993
• Est. Priority Date: 09/29/1989
• Status: Expired due to Term

• Current Assignee: Roche Molecular Systems (Roche Holding AG)
• Original Assignee: Hoffmann-La Roche Incorporated (Roche Holding AG)
• Inventors: Sulzinski, Michael A., Silver, Sheryl B., Longiaru, Mathew
• Primary Examiner(s): Wax, Robert A.
• Assistant Examiner(s): ESCALLON, MIGUEL H
• Application Number:
  US07/414,542
• Time in Patent Office: 1,404 Days
• Field of Search: 435/6, 435/7, 422/56
• US Class Current: 435/6.11
• CPC Class Codes: C12Q 1/6816 characterised by the detection means C12Q1/6804 takes precedence
• CPC Class Codes: C12Q 1/6832 Enhancement of hybridisation reaction
• CPC Class Codes: C12Q 1/689 for bacteria
• CPC Class Codes: C12Q 2545/114 involving a quantitation step
• CPC Class Codes: C12Q 2563/131 the label being a member of a cognate binding pair, i.e. extends to antibodies, haptens, avidin
• CPC Class Codes: C12Q 2565/519 characterised by the capture moiety being a single stranded oligonucleotide

Abstract

The present invention relates to the synthesis of amplified biotin-labelled DNA target sequences of Chlamydia trachomatis by polymerase chain reaction techniques and the detection of such sequences by a microtiter plate having plurality of wells and having bound thereto oligonucleotide capture probe complementary to said target sequence.

Claims

1. A diagnostic kit for the detection of a target nucleic acid sequence of Chlamydia trachomatis, said kit comprising PCR primers wherein said primers are oligonucleotides that will bind to or cause elongation through the following sequences:

space="preserve" listing-type="equation">5'"'"' CCTGACTTGTTGTTACAGGAATCCC 3'"'"' and 5'"'"' GTGTTCTTATTGTTCTGGGGAAGAGG 3'"'"'

and a microtiter plate having a plurality of wells and having bound thereto oligonucleotide capture probe having a nucleic acid sequence substantially complementary to said target sequence.

2. The diagnostic kit of claim 1 which additionally comprises reagents for conducting the PCR amplification and hybridization of said capture probe and said target sequence.

3. The diagnostic kit of claim 2 which additionally comprises Tao polymerase and dNTP'"'"'s.

4. The diagnostic kit of claim 3 wherein one or more of said dNTP'"'"'s comprise a labelling agent.

5. The diagnostic kit of claim 1 wherein at least one of said PCR primers is biotinylated through a linker arm modification at the 5'"'"' terminus.

6. The diagnostic kit of claim 1 wherein said microtiter plate comprises polystyrene having enhanced protein binding capacity.

7. The diagnostic kit of claim 1 wherein said probe is a oligonucleotide that will bind to the following sequence:

space="preserve" listing-type="equation">5'"'"' GGCTTGCAGAGTTCTATAGTGCTATG 3'"'"'.

8. The diagnostic kit of claim 1 which is suitable for detection of Chlamydia trachomatis and wherein said primers are oligonucleotides that will bind to or cause elongation through the following sequences:

space="preserve" listing-type="equation">5'"'"' CCGCACGTTCTCTCAAGCAGGAC 3'"'"' and 5'"'"' GTCTGACGGTTCTTAAGCTGGGAG 3'"'"'.

9. The diagnostic kit of claim 8 wherein said probe is a oligonucleotide that will bind to the following sequence:

space="preserve" listing-type="equation">5'"'"' TTCCGGAGCGAGTTACGAAGACA 3'"'"'.

10. Primers for use in the PCR amplification of Chlamydia trachomatis nucleic acid target sequence, said primers being oligonucleotides that will bind to or cause elongation through the following sequences:

space="preserve" listing-type="equation">5'"'"' CCTGACTTGTTGTTACAGGAATCCC 3'"'"' and 5'"'"' GTGTTCTTATTGTTCTGGGGAAGAGG 3'"'"'.

11. Probes useful in hybridization assays of DNA sequences amplified with the primers of claim 10, said probes being oligonucleotides that will bind to the following sequence:

space="preserve" listing-type="equation">5'"'"' GGCTTGCAGAGTTCTATAGTGCTATG 3'"'"'.

12. Primers for use in the PCR amplification of Chlamydia trachomatis nucleic acid target sequence, said primers being oligonucleotides that will bind to or cause elongation through the following sequences:

space="preserve" listing-type="equation">5'"'"' CCGCACGTTCTCTCAAGCAGGAC 3'"'"' and 5'"'"' GTCTGACGGTTCTTAAGCTGGGAG 3'"'"'.

13. Probes useful in hybridization assays of DNA sequences amplified with the primers of claim 12, said probe being an oligonucleotide that will bind to the following sequence:

space="preserve" listing-type="equation">5'"'"' TTCCGGAGCGAGTTACGAAGACA 3'"'"'.

14. A method of detecting Chlamydia trachomatis by PCR amplification and hybridization assay comprising utilizing in said PCR amplification primers which are oligonucleotides that will bind to or cause elongation through the following sequences:

space="preserve" listing-type="equation">5'"'"' CCTGACTTGTTGTTACAGGAATCCC 3'"'"' and 5'"'"' GTGTTCTTATTGTTCTGGGGAAGAGG 3'"'"'.

15. The method of claim 44 wherein said hybridization assay further utilizes a capture probe and wherein said capture probe is an oligonucleotide that will bind to the following sequence:

space="preserve" listing-type="equation">5'"'"' GGCTTGCAGAGTTCTATAGTGCTATG 3'"'"'.

16. A method of detecting Chlamydia trachomatic by PCR amplification and hybridization assay comprising utilizing in said PCR amplification primers which are oligonucleotides that will bind to or cause elongation through the following sequences:

space="preserve" listing-type="equation">5'"'"' CCGCACGTTCTCTCAAGCAGGAC 3'"'"' and 5'"'"' GTCTGACGGTTCTTAAGCTGGGAG 3'"'"'.