Methods for diagnosing cancer, precancerous state, or susceptibility to other forms of diseases by detecting an acceleration of exon skipping in IRF-1 mRNA

• US 5,643,729 A
• Filed: 02/24/1995
• Issued: 07/01/1997
• Est. Priority Date: 02/24/1994
• Status: Expired due to Fees

• Current Assignee: Boehringer Ingelheim International GmbH (C.H. Boehringer Sohn AG & Co. KG)
• Original Assignee: Boehringer Ingelheim International GmbH (C.H. Boehringer Sohn AG & Co. KG)
• Inventors: Harada, Hisashi, Taniguchi, Tadatsugu
• Primary Examiner(s): Zitomer, Stephanie W.
• Assistant Examiner(s): FREDMAN, JEFFREY NORMAN
• Application Number:
  US08/393,997
• Time in Patent Office: 858 Days
• Field of Search: 435/91.2, 536/24.3, 536/24.31, 536/24.33
• US Class Current: 435/6.13
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: C07K 14/4702 Regulators; Modulating activity
• CPC Class Codes: C12Q 1/6886 for cancer immunoassay for cancer G01N33/574
• CPC Class Codes: C12Q 2600/156 Polymorphic or mutational markers
• CPC Class Codes: C12Q 2600/158 Expression markers

Abstract

The present invention concerns a novel molecular marker useful for diagnosing hematopoietic disorders, including cancers and precancerous conditions. The invention is based on the unexpected discovery that inactivation of the IRF-1 tumor suppressor gene can occur via an altered splicing pattern of the IRF-1 primary transcript. This altered splicing pattern leads to mRNAs lacking exon 2 or exons 2 and 3. The relative amounts of full-length RNA and shortened RNA molecules are significantly different in samples obtained from patients suffering from certain cancers and precancerous conditions as compared to healthy donors.

Claims

1. A method for detecting an acceleration of exon skipping in interferon-regulatory factor-1 (IRF-1) mRNA, the method comprising:

(a) assaying IRF-1 mRNA level in a first biological sample, wherein said IRF-1. mRNA is selected from one or more of intact IRF-1 mRNA, Δ

2 IRF-1 mRNA, or Δ

23 IRF-1 mRNA;

(b) comparing said IRF-1 mRNA level to an IRF-1 mRNA standard level, said standard being taken from a second biological sample not exhibiting accelerated exon skipping in IRF-1 mRNA; and

(c) determining whether said sample exhibits an acceleration of exon skipping in IRF-1 mRNA.

2. The method of claim 1, wherein an acceleration of exon skipping is exhibited if the intact IRF-1 mRNA level in said first sample is lower relative to the intact IRF-1 mRNA level in said standard.

3. The method of claim 1, wherein an acceleration of exon skipping is exhibited if the ratio between the intact IRF-1 mRNA level and the Δ

2 IRF-1 mRNA level or the Δ

23 IRF-1 mRNA level in said first sample is lower relative to said ratio in said standard.

9. The method of claim 1, wherein said IRF-1 mRNA level is assayed by RT/PCR analysis.

11. The method of claim 9, wherein at least one of the oligonucleotides

5'"'"'TTCCCTCTTCCACTCGGAGT3'"'"' (SEQ ID NO:

1),

5'"'"'GATATCTGGCAGGGAGTTCA3'"'"' (SEQ ID NO;

     2), or

5'"'"'CTCTGGTCTITCACCTCCTC3'"'"' (SEQ ID NO;

     3)

is used as a primer during said analysis.

13. The method of claim 1, wherein said first biological sample is obtained from peripheral blood mononuclear cells (PBM) or bone marrow cells.

15. The method of claim 1, wherein said second biological sample is obtained from an individual not suffering from a hematopoietic disorder.

4. A method of assisting the diagnosis of a hematopoietic disorder, the method comprising:

(a) assaying IRF-1 mRNA level in a first biological sample obtained from an individual, wherein said IRF-1 mRNA is selected from one or more of intact IRF-1 mRNA, Δ

2 IRF-1 mRNA, or Δ

23 IRF-1 mRNA;

(b) comparing said IRF-1 mRNA level to an IRF-1 mRNA standard level, said standard being taken from a second biological sample riot exhibiting accelerated exon skipping in IRF-1 rnRNA; and

(c) determining whether said sample exhibits an acceleration of exon skipping in IRF-1 mRNA, whereby an acceleration Of exon skipping in IRF-1 mRNA is indicative of a hematopoietic disorder.

5. The method of claim 4, wherein an acceleration of exon skipping is exhibited if the intact IRF-1 mRNA level in said first sample is lower relative to the intact IRF-1 mRNA level in said standard.

6. The method of claim 4, wherein an acceleration of exon skipping is exhibited if the ratio between the intact IRF-1 mRNA level and the Δ

2 IRF-1 mRNA level or the Δ

23 IRF-1 mRNA level in said first sample is lower relative to said ratio in said standard.

7. The method of claim 4, wherein said hematopoietic disorder is a myelodysplastic syndrome (MDS) selected from refractory anemia (RA), refractory anemia with ringed sideroblasts (RARS), refractory anemia with excess of blasts (RAEB), RAEB in transformation (RAEBT), or chronic myelomonocytic leukemia (CMML).

8. The method of claim 4, wherein said hematopoietic disorder is selected from acute myeloid leukemia (AML) or overt leukemia from myelodysplastic syndrome (MDS/Leu).

10. The method of claim 4, wherein said IRF-1 mRNA level is assayed by RT/PCR analysis.

12. The method of claim 10, wherein at least one of the oligonucleotides

5'"'"'TTCCCTCTTCCACTCGGAGT3'"'"' (SEQ ID NO:

1),

5'"'"'GATATCTGGCAGGGAGTTCA3'"'"' (SEQ ID NO;

     2), or

5'"'"'CTCTGGTCTTTCACCTCCTC3'"'"' (SEQ ID NO;

     3)

is used as a primer during said analysis.

14. The method of claim 4, wherein said first biological sample is obtained from peripheral blood mononuclear cells (PBM) or bone marrow cells.

16. The method of claim 4, wherein said second biological sample is obtained from an individual not suffering from a hematopoietic disorder.