Telomerase activity assays for diagnosing pathogenic infections

• US 5,695,932 A
• Filed: 05/13/1993
• Issued: 12/09/1997
• Est. Priority Date: 05/13/1992
• Status: Expired due to Term

• Current Assignee: Regents of the University of California (University of California), University of Texas System
• Original Assignee: Regents of the University of California (University of California), University of Texas System
• Inventors: West, Michael D., Wright, Woodring, Shay, Jerry, McEachern, Michael J., Blackburn, Elizabeth H.
• Primary Examiner(s): Campbell, Eggerton A.
• Application Number:
  US08/060,952
• Time in Patent Office: 1,671 Days
• Field of Search: 435/6, 435/7.2, 435/91.1, 435/91.2, 935/77, 935/78, 436/501, 436/34, 436/63, 436/64
• US Class Current: 435/6.18
• CPC Class Codes: A61K 31/522 having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
• CPC Class Codes: A61K 31/70 Carbohydrates; Sugars; Derivatives thereof sorbitol A61K31/047
• CPC Class Codes: A61K 31/7076 containing purines, e.g. adenosine, adenylic acid
• CPC Class Codes: A61K 31/711 Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
• CPC Class Codes: A61K 38/00 Medicinal preparations containing peptides peptides containing beta-lactam rings A61K31/00; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, A61K31/00; ergot alkaloids of the cyclic peptide type A61K31/48; containing macromolecular compounds having statistically distributed amino acid units A61K31/74; medicinal preparations containing antigens or antibodies A61K39/00; medicinal preparations characterised by the non-active ingredients, e.g. peptides as drug carriers, A61K47/00
• CPC Class Codes: A61P 35/00 Antineoplastic agents
• CPC Class Codes: A61P 43/00 Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• CPC Class Codes: C12N 15/10 Processes for the isolation, preparation or purification of DNA or RNA chemical preparation of DNA or RNA C07H21/00; preparation of non-structural polynucleotides from microorganisms or with enzymes C12P19/34
• CPC Class Codes: C12N 15/113 Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing when used in plants C12N15/8218
• CPC Class Codes: C12N 15/1137 against enzymes viral enzymes C12N15/1131; receptors C12N15/1138
• CPC Class Codes: C12N 2501/70 Enzymes
• CPC Class Codes: C12N 2510/04 Immortalised cells
• CPC Class Codes: C12N 5/0018 Culture media for cell or tissue culture media for specific animal cell type C12N5/06
• CPC Class Codes: C12N 5/163 one of the fusion partners being a B or a T lymphocyte
• CPC Class Codes: C12N 9/1241 Nucleotidyltransferases (2.7.7)
• CPC Class Codes: C12Q 1/48 involving transferase
• CPC Class Codes: C12Q 1/68 involving nucleic acids
• CPC Class Codes: C12Q 1/6827 for detection of mutation or polymorphism
• CPC Class Codes: C12Q 1/686 Polymerase chain reaction [PCR]
• CPC Class Codes: C12Q 1/6876 Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
• CPC Class Codes: C12Q 1/6886 : for cancer immunoassay for cancer G01N33/574
• CPC Class Codes: C12Q 1/703 : Viruses associated with AIDS
• CPC Class Codes: C12Q 2521/113 : Telomerase
• CPC Class Codes: C12Q 2600/112 : Disease subtyping, staging or classification
• CPC Class Codes: C12Q 2600/136 : Screening for pharmacological compounds
• CPC Class Codes: C12Y 207/07049 : RNA-directed DNA polymerase (2.7.7.49), i.e. telomerase or reverse-transcriptase
• CPC Class Codes: G01N 2333/91245 : Nucleotidyltransferases (2.7.7)
• CPC Class Codes: Y02A 50/30 : Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
• CPC Class Codes: Y10S 977/773 : Nanoparticle, i.e. structure having three dimensions of 100 nm or less
• CPC Class Codes: Y10S 977/801 : Drug
• CPC Class Codes: Y10S 977/918 : Immunological
• CPC Class Codes: Y10S 977/927 : Diagnostic contrast agent
• CPC Class Codes: Y10T 436/10 : Composition for standardization, calibration, simulation, stabilization, preparation or preservation; processes of use in preparation for chemical testing
• CPC Class Codes: Y10T 436/105831 : Protein or peptide standard or control [e.g., hemoglobin, etc.]
• CPC Class Codes: Y10T 436/11 : Automated chemical analysis
• CPC Class Codes: Y10T 436/115831 : Condition or time responsive

Abstract

Method and compositions are provided for the determination of telomere length and telomerase activity, as well as the ability to inhibit telomerase activity in the treatment of proliferative diseases. Particularly, primers are elongated under conditions which minimize interference from other genomic sequences, so as to obtain accurate determinations of telomeric length or telomerase activity. In addition, compositions are provided for intracellular inhibition of telomerase activity and means are shown for slowing the loss of telomeric repeats in aging cells.

Claims

1. A nucleic acid method for detecting the presence of a eukaryotic pathogen in a patient wherein presence of said eukaryotic pathogen is detected by their telomerase activity within a somatic cell population or tissue, comprising the steps of:

obtaining a sample of somatic tissue or cells from said patient;

determining whether telomerase activity is present within said sample in said patient; and

correlating presence of telomerase activity with presence of said eukaryotic pathogen.

8. The method of claim 1, wherein said determining whether telomerase activity is present comprises the steps of:

incubating said cells or tissue in a reaction mixture comprising an oligonucleotide primer that can serve as a substrate for telomerase-mediated primer extension, nucleoside triphosphates, and a buffer under conditions such that, if telomerase activity is present, said primer is extended by telomerase-mediated addition of nucleotides derived from said nucleoside triphosphates to said primer; and

,

correlating extension of said primer with the presence of telomerase from a pathogen.

2. A nucleic acid method for detecting the presence of a fungal infection in a patient wherein said fungal infection is detected by their telomerase activity within a somatic cell population or tissue, comprising the steps of:

obtaining a sample of somatic tissue or cells from said patient;

determining whether telomerase activity is present within said sample in said patient; and

correlating presence of telomerase activity with presence of said fungal infection.

3. The method of claim 2, wherein said method further comprises characterizing said fungal infection, by the steps of:

contacting said sample with an oligonucleotide probe complementary to a telomeric nucleic acid sequence of a fungal cell;

allowing said oligonucleotide probe to hybridize to telomeric nucleic acid of a fungal cell contained in said sample;

characterizing said fungal infection as a fungal infection by a particular genus or species of fungus, as measured by specific hybridization of said oligonucleotide probe.

4. The method of claim 3 wherein the fungal cell is of a genus selected from a group consisting of:

Candida, Kluyveromyces, and Saccharomyces.

5. The method of claim 4 wherein the telomeric nucleic acid of the fungal cell comprises a sequence selected from the group consisting of:

ACGGATGTCTAAC (SEQ ID NO.

     8);

TTCTTGGTGT (SEQ ID NO.

     9);

ACGGATGTCACGA (SEQ ID NO.

     10);

TCATTGGTGT (SEQ ID NO.

     11);

AAGGATGTCACGA (SEQ ID NO.

     12);

ACGGATGCAGACT (SEQ ID NO.

     13);

CGCTTGGTGT (SEQ ID NO.

     14);

ACGGATTTGATTAGTTATGTGGTGT (SEQ ID NO.

     15);

ACGGATTTGATTAGGTATGTGGTGT (SEQ ID NO.

     16);

CTGGGTGC (SEQ ID NO.

     17);

TGTGGGGT (SEQ ID NO.

     18);

GTGTAAGGATG (SEQ ID NO.

     19); and

,

T(G)_2-3 (TG)_1-6 (SEQ ID NOS. 20, and 47-57).

6. The method of claim 3 wherein the fungal cell is of a genus selected from a group consisting of:

Sporothrix, Coccidioides, Histoplasma, Blastomyces, Paracoccidioides, Cryptococcus, Aspergillus, Mucor, and Rizopus.

7. A nucleic acid method for diagnosis of a malarial infection in a patient wherein said malarial infection is an infection by a malarium selected from a group consisting of:

Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, and Plasmodium falciparum, wherein said method comprises the steps of;

obtaining a sample of somatic tissue or cells from said patient;

determining whether telomerase activity is present within said sample in said patient; and

correlating presence of telomerase activity with presence of said malarial infection.