Method of detection of carcinogenic human papillomavirus

• US 5,783,412 A
• Filed: 08/25/1989
• Issued: 07/21/1998
• Est. Priority Date: 02/26/1987
• Status: Expired due to Fees

• Current Assignee: Polartechnics Ltd.
• Original Assignee: Biosearch International Pty. Ltd.
• Inventors: Nightingale, Brian, Morris, Brian James
• Primary Examiner(s): ARTHUR, LISA BENNETT
• Application Number:
  US07/423,401
• Time in Patent Office: 3,252 Days
• Field of Search: 435/5, 435/6, 435/91.2, 935/77, 935/78, 536/27, 536/24.32, 536/23.72, 536/24.33
• US Class Current: 435/5
• CPC Class Codes: C12Q 1/686 Polymerase chain reaction [PCR]
• CPC Class Codes: C12Q 1/708 for papilloma

Abstract

Carcinogenic human papillomavirus types HPV16 and HPV18 are detected in a sample of cervical tissue. A selected characteristic DNA portion of the virus defined by oligonucleotide primers is amplified using a polymerase chain reaction involving successive heating and cooling steps, for example up to 250,000 copies. The presence/absence of the characteristic cloned DNA portion is detected by gel electrophoresis or using a labelled oligonucleotide probe.

Claims

1. A method for detection of carcinogenic human papillomavirus HPV16 and HPV33 or HPV18 which comprises;

(a) applying a polymerase chain reaction technique to a sample of human cervical tissue cells so as to amplify the amount of a selected nucleotide sequence located within the E6 region and characteristic of carcinogenic HPV16 and HPV33 or HPV18 present, comprising the steps of;

(i) heating to dissociate the DNA strands,

(ii) adding oligonucleotide primers defining each end of said nucleotide sequence,

(iii) cooling to allow the primers to anneal to the dissociated DNA strands,

(iv) adding DNA polymerase,

(v) allowing formation, at the cooled temperature, of DNA complementary to each strand of said nucleotide sequence,

(vi) heating to dissociation temperature, and repeating steps (iii) to (vi), optionally omitting step (iv) where a heat stable DNA polymerase is used; and

(b) detecting the presence or absence in the amplified sample of said nucleotide sequence of HPV16 and HPV33 or HPV18 wherein the pair of primers defining the selected nucleotide sequence are;

for HPV16 and HPV33 ^5'"'"' TGAGGTATATGACTTTGCTTTT^3'"'"' and ^3'"'"' AATTAATCCACATAAT^5'"'"'

or for HPV18 ^5'"'"' ACAGTATTGGAACTTACAGA^3'"'"' and ^3'"'"' TTTACATATCTAAAAATAAG^5'"'"'.

2. A method according to claim 1, wherein the DNA polymerase is a polymerase stable at the dissociation temperature.

3. A method according to claim 2 wherein the DNA polymerase is a thermophilic polymerase from Thermus aquaticus.

4. A method according to claim 1 wherein the presence or absence of said nucleotide sequence is detected by separating the components of the amplified sample on a gel and detecting the presence or absence of a DNA having the same number of nucleotides as said nucleotide sequence.

5. A method according to claim 1 wherein in order to detect the presence or absence of said nucleotide sequence, there is added a labelled oligonucleotide hybridization probe corresponding to a region of said nucleotide sequence.

6. A method according to claim 5 wherein the oligonucleotide probe is:

(i) for HPV 16 and HPV 33 ^5'"'"' GTGAGTATAGACATTAT^3'"'"' or

(ii) for HPV18 ^5'"'"' GATTTATTTGTGGTGTATAGA^3'"'"'.

7. A method according to claim 6, wherein the oligonucleotide probe is labeled with a ³² P radioactive label.

10. A method according to claim 5 wherein the oligonucleotide of the labelled oligonucleotide probe is

(i) for HPV16 ^5'"'"' GTGAGTATAGACATTAT^3'"'"' or

(ii) for HPV18 ^5'"'"' GATTTATTTGTGGTGTATAGA^3'"'"'.

11. A method according to claim 1 to detect HPV16 and HPV33.

12. A method according to claim 1 to detect HPV18.

8. A primer composition which consists of:

(i) for HPV16 and HPV33 a mixture of ^5'"'"' TGAGGTATATGACTTTGCTTTT^3'"'"' AND ^3'"'"' AATTAATCCACATAAT^5'"'"' or

(ii) for HPV 18 a mixture of ^5'"'"' ACAGTATTGGAACTTACAGA^3'"'"' and ^3'"'"' TTTACATATCTAAAAATAAG^5'"'"'.

9. A labelled oligonucleotide probe wherein the oligonucleotide is

(i) for HPV16 GTGAGTATAGACATTAT or

(ii) for HPV18 GATTTATTTGTGGTGTATAGA.